Description :
From Genome Similarity Track
Location :
Scaffold_344:15299- 20112
Sequence
4813 bases(100 bases per row)
GCTGTGCCCATGCCTTTATTGACACGGTCTTTCGACTCCACAGTCTGCCTCGTGAACTAGTCTCAGACCGAAATCCACGGTTCACGGCGGAATTTTGGTA
ATCCGTGTTCCGATCACTCGAGACACGCCTGACCATGTCAACATCTGACCATACAGAGACAGATGGTTAGACGGATCGCGTCAACCGCGTCTTCGAAGAG
ATACTACAAGGGCACGCCCAATCTTCCACAGCTTGAAGCGACTTCTTGCCAATGGTAGAGTTTGCCATTAATAACTCGGTGCATGCGTCCACAACGCATA
CACCGTTCGTCGTGATCCACGCCTACCGGCCCACTTAGAATGTGACTCTGGTCCAATGGGGGATATTTCGCTCGAGAAAAACTATTCTAGCTCTTGCTCA
TCACGCGTCGAGGTACTCGACGACGCGAACGTTGACGATGTCGATCAAATCGAAATCGAAGAAGATACCCTCAGCAATAGTGACGACACTGTTGCTGACC
CAGATGAGGATGACGATGCTGGTATATTCAGCATCGACAATGACTACACCAGCGAGGATGAGAACACACTCGCTGAAGAATAGAATGACCTCGTAGCGGT
GCGCACAAGGTGCACAGAAACAAACAAAAGCGATTCAGCCGAAGAATTTCTGCTGGCACGAGTGGCAGTGGCCCGTTTCGTACAAGACTATATAGCTAAC
GCGGTGGACCGGCAGAAACGTAACGCTGATAGAAATGGAACAGCAAACGTTCTTCTATTTAATGTTGGAGACTTAGTCCTACTTTCTACGGTAAATCTAC
CTAAGCACGTAGTAACTAATATGGGTAGTAGTAAACAGCTACCCAAGTTCATCAGCCCATTTTGTGTGCTGCATCGCAAAGAAAATGCGTACACGATCGA
GTTGCCTCTCAGGATGCGTACGCATCCTACGTTTTATGTTGGTCGCCGCCGCCCGTACCATCAGCACGAGGTTTCTTCCTCGAGCGAATACAGCCGCCAC
GCTCATAAATTTCCAAGAGATTCTTTTGGTCCCGAGTCGTTTTCTCAATATGACTCTGAAGCGTCACCATCTGGCGGCGAACATCAGCCACTTCGTCGCG
AATGGCTTGACGTCCCAGCTCGTTCTCCAATTGGGAGAACGCAAACTCCGATCAGTCGTCCGACCGATGAAGGCAGTAGCGCTGCACCGACGCCTCCAAA
GAAAGCCGTTCCTGCCTCTCTTGTTCGATGCTATCACGCATATCGTGGGGACGTCGCTCCGGACGACCTGCCTCCACTTCCAACTCCAAAAAGAGATTCG
GAGTTGATATTCCTGCCCCCACCACAGCCACTGGTGGACTCACACGATGGTCAAAGATTTCACGTGGAGCGTATCTTAAACCAACGTGACGTGAAGGGGC
AGCGAACGAGTCACCTCGTTCGCTGGCGCGTCTATCCGCTGTCGCACGACAGCTGGGAGACCTGTGCCCAGATGATGATGGACGTTAACCGTCTCGTCCA
CCAGGACTACGAGATACATCCGATGACTCAGAAGGGCTATAGGAAAACATGCGCCCATGGCGCTGGTAGAGCGATTGCAGATTAGGAATCGCATCGCGCA
TCTCAGTAGAGATGTGCGCCCTACCCCAGGGAGAAGAAAGGGAGTACACCTCCCTTTGGGTGCGCTGAGTGTTGTCAAACAACACGGACAAATGTCACCT
CACGTGAGGCATGGAATTTTTGCCTCACGAGACAAACGATGCAACCTACCTTTTGCACCAATATGGTTCGCTTCTCAAACCTAACAGGAGCTGTTTTAAG
TTTTTGAAGTCAAGCTCCGCGTCCAATTTGCTGCACATCGAGCACACAGGCGTTTCACTCCTGCAGCAACGAGCTTTTGTATCACTTTGTGCTGCCACTG
TACTAACGATGTTTCAGAATAGCGTCAAGGTAGAAGTCTTCTTCAGCGCGAAAGTTACTCGCGCTGATGTCGAGGTTGTGCAGCAGCCTCGCATCGAATA
ATGGAATTTGATACTGAAAACTGTTCTTGCCGGACAAGTCATTCACAAGAACTTCTGGTAGTACCCTAGGCTTGTATTCAGGGGCTAGACGCAGCACATT
GCCGTCCAGGTCCTCTTGCGTAGTACCAAAGGAAGCCTTGGTACCACTAGAGTCGCCATCGATGGCGCAAGTTATAGTCGCATTTGATAAAAGGCGGATG
TGCAGTAGCAGGCACGGGGGATGAGTCACCATGCTCATTCTCCGAACTAAACAGACTGTGGTAGTGATCATGAGTCTGACCACCTGATCGAGTCCTATTC
GAAGGCTCATACTCGGCCGCTCCAGTAGACTCGGGCGACCTAGGTGTCTTCTTCGAGTTGGACCCACCCTCCGACTTCCGAGATTAGATGAGCTCCACTT
GAGAGCCATCATCAGTAGCACGTGGTGACTCACTACGTGCATCTGCAGCAACTGTTGCCGCCGGAAGAGTTGAAGAAGTAGCAGACAAAACATCTCCTGC
CGCACGAGGCTGTGAACTTTCACGAACAGCTTCTTTCTCAGCAGATATCGCCGCACATCGCATGAGTTTCTTTGCCATGCAATGAAAAGTCAGAAATGTG
TGGATCTGACCGAACAAGTGCTCCCTGTCGCTGATGAAGTCTAACGGTGACCACATCAAACATGATAGTTATTGATCAACTATCATGTTTGATGAGTCTG
TTACATTTGATTAACTCTCAATACTTGTTAATTAGAATATTATCATGAAGGCTTATAATGTTCGTGAATGTTACCATACGGGGTAATATTCAGAAGCACT
CACCTATTGGCTGATATGGGCCATCATGTCAGTCAGCTCTAGCGGTGCAATCAGTGATGAGCGTGCGCAATGAGTTGTGAGCAAGAGTTCAGCATACATT
TTGGTAGACACATATAATTAAGATAAGACTAAAACATAGGATAATAACTAGGACTTAATTATATTTAATACAGTTTTACTTTCTACTTCTATTGACCCCG
TAGTTCAATAGCTAGCCTTCCTCTGCACGTACGGTGTACGTGAAGCTACATGCGGCACTTACTTACACGTTGCCAGTGTAAGTTGACTTGTACTGTGTCG
GTGCAAGTCACCACTGCCCCGTCACATTCCCGATCCTAAAGTCGTGCGGAGATAATAGTGCGGCGAATCTGACTCGGATTGTTTTCCCGGCTAATAATCT
ATATTTTATACTAAGGCGTTGCAGTAATGCCAACACTTTGCGGTGATGTTGCGAAGTTTGCCTCCAAGCTACGAGAGCTTGGTTCAGGCATTTCGCATGT
CGATTACAAGCTTCAACTTCAGTGACCTCGTGAACAAGTTAATTGCTGAGGAAGTGCGCCAGAAGGAGGCAGCACGGGTAGGAGAAGCAACGGCTCTCTA
CACAGGCAAGAAGAAGGGCAAGCAGCAACCGAAGATGCAGCCAGGAAGGCGTACGAAAGGACCTGCTGGAGCGTGCTACAATTGTGGCAAGGTAGGCCAC
TACGCAAGAGATTGTCGATCAAGTCGTGGATCAAGCCAAGCAGCGCATGACCAGTCAAACGTCGCGTTTAACGTCAGTGAAGGCTTTGTAAGCGACTGCT
GGGTCATGGACAGCGGCGCATCGGCACATATGTGCAACGACCGTGATGCCTTTGAGGATTACGAGGAAGCGCAAAATGAGCGAAGTGTATCAAGCGCGAA
GAATGACGTCAAGCTACAAGTTATCGGTCAAGGGACGGTAAAGCTGCGCGTTTGGACCGGGTATGCATGGATCGATGCTCGACTTGAGAACACGCTTCAT
GTTCAAGATTTGACGAAGAATCTGTTCTCGCTTACGGCAGCAGCAGCGCGAGGAATGACTGTGGAGATTACTTGCAACGAGTGCGTGGTAAGGCGTGGTG
GCACACCGGTCGCCACCGGAAGGAAGCAGGGTTTCCTGATATACCTGAATATTGAGGTACATGCAGAGTAACATGTAGCAGAAAATGAAGGTGAGCTATG
GCATAGAAGACTGGGTCACGCGTCGTACGGCACGGTTAATGCTATGATCAAAGACGGAAGGATCAAGGGCGTGAAGATGAAGACGGACGTTGTCTGTGAC
GTATGTGCAACGTCAAAGCAAGTGCGCAAGTCGTTCACGACATCCGAGGAAGATGCAGAGCTCAGGGAGGTTGCGCGTTCTGACGAGATGGTGTGCTCGG
ACGTTCTTGGACCTATAACACCAACGTCAAGATCTGGTTTCAAGTATATTGTGAGTTTCATCATGATGAAGAGCCGGTACGTGACGGTCTTCCCAATGCG
AAAGAAAAGCGAGGTTACCAGCGCGTTTGCAAGGTTCTACCAAGAGATCAAGACGTTGACGGGGAAGAAGATCAAAGTGCTCCGAAGTGACAACGGTGGG
GAGTACCGAAACGCTGCGATGGATAAGTTTTGCAAGGCGAAATACATCAAGCAAGAGTTCACAGTACCGTACAATCCTGAGCAGAATGNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNN