Description :
From Genome Similarity Track
Location :
contig_71:152953- 157990
Transcript NameFunction/comments
g11932.t1XP_009535697.1 hypothetical protein PHYSODRAFT_564803 [Phytophthora sojae
g11933.t1hypothetical protein

Sequence
5037 bases(100 bases per row)
AGTTCATTCTAAGAGATACACCTCGTCATATCAGATAGTCACCGACAACAGACCCTTTTTAATCAGATAATAGTGTCACAGGTCATTTTACTAAGAATCA
ACAAAGTCTTTCCATCTCGATCTGTAACCACGTATGGTCCATATACTAATACAATTAATTCTCACAGGACAACGACCTGCTTCAGAAATATGCAGCAACT
TCAACTATTGCGTCGCGCGGTCTCCGTTGACGGCAGCCATTCCTTCATTTCCCTCGCCCCAAGGAAGACATTTGCACTACAGGAAGCAGCAAAACACCCC
TATGACAGGTCTATCCGACACTGTAAACTCGGATGAAAATCCTCCGCTGGCGGAGCTGCGCAGACTCAAGTCGCAAGCGCAAAGTGGCGAACGTCGTCGC
CAACTTCGACGCGAAGCCCAGAAGATCGAGAGCAAAAAGCCCAACCCATCGGACCCCGAGCCACAAGAAGCAGAGATGGACGAAGCCGCAACGCAAGAAG
AAGCGCAACTTTTTCAAGTGGCTGCTCACGCCGTCTGTGGCGACCAACCGCCAAGTGGCTCCTCCGAGAGTTCGCGTCAAGATCCCCATCGTGTATCGCA
ACGGCGAGCACAAAGGCGTCGTGGTGGGTGGAGTGCGGGTGCCATTCTCGCGGCCAATGCAGGCGAACCGCCGACGTTTGTTGCTGTCTCGAGACGACGT
GAGCTCCGTCATTCCAGAGGACACGGAGTTCGTGCTGGAGTTCCCGCCCAGACTTGCTCGCGAGGAATTCGAGACGGAACACAAGCGCAAAGAGCAAGAG
AAGAACAAGTTGAAATACGAGAAACTGGCAAAAGAACTGGCCAAGTAAGTGGTCGGCACTGCCTGTCGCCGTGTTCATTCAGAAATCACCACCAAAGTCT
CCACCATCGAAGCCACCACCACCATCGAGGCCATCACCACCATCGAGGCCATCACCACCGTCGCCAAAGCCGCCTCCATCGCCGTGGTCAGCTAACGTCT
CTCCGAGTAAAAATCCACCGAGAAGACCAGCAGCTCCGCCCAACGCAGCCCCAGTGCCGGCCCCCATACCACTCCCTCCATTTCGACCGTAGTACCGACC
GTATGCAGGGGTAGCAGCACTCGCAAACGGAGCTGTAGTCCCGTATGGCTGATCGGAGCTTCCTCCCGGTATTGGACTGGAGACGGGAGCTGCCATGGGG
ATCGCACTATCCGCGCCGTGCTCTTTAGCCCGTCTAACAGCATGAAACAACAGCCACCGCAGCACAAGACCAACGCTAGAGCTCCCAAGAACCACCACAA
CCAAAGTAGACCACCGCCATCTCCGTCACCTGCGCGGTACGGGGCATACCCGCAGTTGCAGGCGTAATTGGAGACCTTGCAGACGGCGTCATCGGGGCAG
CAGCAAGGTCGTCGTTCGTTCTGGCGGTCCAGCCAGTTGCCACAAAATTGGCCATGCGTACCGTGGTAGGCCCGAGAGCAGTCCCCAGTGCTGGCACACA
CGTCGCAACCTGACTGCGTGCCGTTGGTTGGCCCGAGGCTGCGTGGATCACCGCAGCGAGCGTTAACAGCCTCCAGAGCTCGATCATCGCGATCTCTTGT
TACCGCAGTAACTATCGCTTCTGATCACTTTCGCAGACAAGAACTTCCTGTCTCACAAAGCGGGACAATTACAGACTACAACCATGATTAGAAGGTAGAC
AGATTGGACCAGACTTGATCTACACTACTGTGATTAATAGATTAACTTTTGTTGTAAACTGGAATATGACGTTTCCTGCGGTGTTTGGTTATCTACATCG
TGAAAGGATTATTTAAAGCGTCGCGACGCCTCGGATACAAGAGCTCCCGCAGATTTCAATGGCACCGCTCAAGATCCTAATCGTTGGGCCCAAGGAGGCT
GGCAAGTCCACCGTGCGTCGATGCAGTAAGCTGCAATGCACTCGCTGTGACGTTGCACTCACCGCTTTGTATCTTTGCGCTCTATTCTTCAGATCGCCAA
CTTCCTCGCAGAACACTCGGATCGACTCGGCGGTCAGGAACGATACCAACCCACTATGGGGTGCGGATTCTCGAGCTGGAGAAAGGCAAGGCGACCGTCG
AGCTTTGGGATGTATCAGGCGACCAGAAGTACGCCTCCTCCACATCCTATTACTGCTTGCCTTGGTCTCACTCGCAACATTATTCATGTCTGCAGCTACG
AAGCTTGTTGGCCAGCTATCATGAAGGATACAGACGGCGTCATCCTCGTTTACAACCCGGAGTCTCACGTTCACGAGAGCGAGGCGATGCTTTGGTTCGT
GGTCGCCACCAGTGTCAAGTATTTTCAATTACTCGAACTAACACTGTTGAACGATTAGGTACGAATGGTTCATGCAAAGTGCCGGCTTAGACAGCTCTCA
GTGCCTTATCTTCGAGCACTCGACGGGTAGCAACAACGCTGCAATTCCGATAGCGTCAAAATCGCGTTTGCCAAGTCATTTGCGTGTCGTCGCAACTACA
TTCGACACGCCCAACGTCTTCAAAAGCGAGTTTAGCCGACTCGTAGCCGCTGCACTCGTGCGCCAGCAGCGTACGGGAAATCGCAAGTGAAGCGGCCATC
TTTGAGATGTAGCACGACAATCGTACGTTAGCGAAGAATCGTCACGAAAATGCTGTTTTCATGAGGTACATTGGTGTCACTTAGGCTTTCGTTACGACGT
CCTACATGTAGCTATCATCCTCAGGTATGTATGAAAGGTAATAGGGACGCCGAAGACCGTTTTGAGGACGACGGCATGCTCCAGCGACCAGTAGTTTGGA
ATTGAGCCATTACGGCGATGGGTGGGACAAAATAGTGTGCTCTCGTGTGTTCCCGAGCCTAAGTGTGGTGCTGTCTTTTGGGCTGGAACTGACAAACGTT
AAGTACTCGCTGCAACAGAGGTGCATGGCCTATTGGGGTTGTTTGCAAGACACTCAGCTATCGATAACTGACGGCGCGTCACTCGCCATGATGTTAGTCT
ACAATCTCCTTCTTTGTTCTGATGCGCGTATTGCGTCAAATGGACACATATTGTGGCCATACTTTGAGGGTTAACATGTCTTTGACCTACATTTCCTGCC
CTCATAATACAATACGTTAACGCACTTGACAGCCTCGTTGCACTGCCTGAATGCTCAGTGTCTGAGCAGCGACGATTGAGCTATGTGGTAAAAATTTGCC
GCAAAATGCTTGCGCGTGGATCCGAGACCAACCTGCTTCGGCAACGAAGTCCGCAAAGATCGCAAGGAGTCAGGCTTATTAAGGGGTATGAAAAGAGATT
GTCTCTCTGTTCTATTTAACCAAATGCTGACTACAATGACGCCCCCCACACCTTTTAAGCCACCGAGCTTCCACGGGGTGACAAAATCATCCGGAACGTA
TCGGTCGCCGGTCGCAGTCGCGTACATGCCCAGCAACGGCGCAACATCTTGACAAATGCTTTAGGCGACAGTCTCTATCGAGTCCCAACGTCCAACCAGT
CTGCATCGCAACCAAATTGCGAAAAATAAGACCCGTTGTTCCTCATCGTGTAGAGTGCCATTCCGAGACTTACCCCCCACGCATGCTTTGGCCAAGGATC
ACGTGACGGGCGGAACCTTGCAGTGCTCATTTTTGCGCCGCAAAAGTCTTCAATGCTGGCACTATGCGACTGAACCACGAGCACCCCAAGCGAAACCCAT
TGAATCAAGAAACACCTTATTGAGTCGACTGCTTTACGTAGGAGTGGCCGCTACGAATCCTGTTGACAGTGTTACGGAGAGCTAGTCCCCACACTTCCTC
CGGCCATGGGATGTAAATCGTGGCGATCCTTTTGCCTCCGTTTACAAAGAATTGTTCTGTGCAATTACTATGTAGCCGAGATCGCGATGAGAGCAGAGTT
CACAACATTCATTCAGACTATTGGGTGGCAAGGACTACAGTTGAACCAACCAGAAGATGCGATCCACCAGTTCACGAGATGTTTGCGATTGCGTTTCGAT
TCGGGATAGCATCATCGCTACTTGTACATGTAATCGCACTTCATGTGACACTCAAAGGGGCTAGCCAAATGGCGCGTTGAAGTGCCTTATGCCGCAATCT
TCCTTGAGAGGCGTAAGTCTACAGCTTCAACCCGTTGATACACTCAGTCATTCTCAATCTTCCCTCTGACCGCGCACATGAGCCCCCCACCAACCATGAA
GAACGCTGTTTACCGATTCGGTGATCGCACTTCCTACAAGACCATCAAGCAAACCACGGAGCCCGTTCCAGCCGTGCGAGACCACGAGGTGCTCGTGGAA
ATTCACGGCGTGACGCTGAACTACCGCGACCTCGCAATTTCCAAGTCCGAGTACCCCAGCACCGTGACGGAGCATGTGGTGCCATGTTCCGATGGTGCCG
GGGTCGTGGTCTCCGTTGGCTCTGCGGTCGAAGACATCGACGTGGGTGACCGAGTCATCACCAACTTCGACGTCACTAATCTCTACGGCCCTGTGCTCAA
CGGAGGCTCGCACCGACTGGGTGGCGTGCTGGATGGCATGTTGCGGCAATACGCAGCAGTCCCAGCTCAAGCAGTGATTAAAATTCCGGAAGAGTGCACA
CTGGACTTCGTGCAGCTTGCGTCGTTGGTGTGTGCTGGTGTGACGGCTTGGAACGCGTTGTACGGCCTTGCTCCGCTGCGTCCAGGACAAGTTGTGCTTC
TTCAAGGCACGGGTGGCGTCTCCATCTTCGGTCTGCAGCTCGCCAAAGCTGCGGGCGCCGTCACGATCATCACTTCCTCTTCAGACGAGAAACTCAAGTT
TGTCAAGGAGAAATTTGGCGCCAGCTACACCATCAACTACCGCACGACGCCGGATTGGGCCGCCGAGGCGAAGCGCATCACGAATGGCAAAGGTGTTGAC
TTTGTTGTTGAGAACGGTGGCTCCGGAACAATTGCCCAGAGCATTGACGCGGTGGCCCCAGGGGGTCAGATTGGCTTGATCGGCTTCTTGGCCCGTGCAA
CCCAAGAGAACATGCCGGATGTCGCGGGGCTCATCCT