Description :
From Genome Similarity Track
Location :
Scaffold_74:152935- 154669
Sequence
1734 bases(100 bases per row)
tattgcgaatgacatcaacacatctattcgaaccaaggtaatgtttatacaaagctacctgtcagcttctagcttcgcgctaaactcgttgaacttgatg
aacgactgcatttcagacacagctgagacagcatcatcaccaagtcgggctcgtcgatcacttactgttgctccagctgcagagaaagcttgttcacttg
gaactgacgtcgccattaccgcgagataatctcgggccatcatccgaattctgggaaactgatcaagcgttttcatccacgcacaaacttcggcgctgct
tgagttagaggtcatggtgcggtcccggtgtgcgatccatcgatcaagctccgatacaaacgactcaccatcgaaattggccggctcgtcaagaccaaag
ttatcgtcaatcagatgatggagcacttcgcccaatttgatctctgctgccgcctgctggtttggctggggtgtattctcgttttgctgctgcttctcgt
acctgattctgtagtacgcttcgtactcgtcgagaacgtgctgtctgatcggggccatgtctggaacaacttttggaagaagcgattttgcccgaggatc
cagaacagcagcgatgtaagcctctggggttttgacgaggctgtcgtattcatccatcttggacttgaaggcagtggcgaatttgatggtgtaaggcgaa
gatgagctcgcaattgtttttgcggcgctctttccgacaagttcgtagactacgactgacatgccaaatgtcggatagtttcttcctgacatcattgtgg
tagcagcctttacgggggtcagaaacttgcagaattcatccagcgaagtccaagcgtcgtcgtcaataggggcagctaattcgtcgtcagccttaatcga
gaaatctccgtagccttcatggtggtctcgaatgcggtgcaacagctcctcaattggttttcgaaggtgaattgcagatactaccatctcccatgtactg
ttccagcgtgtgacacagtctaactttggttgttgaaacttcacgtttaggacatcacatattctttgaagctcctcattgagtgaagtagagtctgata
gcttcttcatgatgtcgcgcacggttccgatgctggtttcgacgaacttacattttagaaggccctccttaacggcaagctgcagcacatgagctaggca
tcgtactcggaagacattttgaggttcatcgtttccgtgatacgttgatgaagacatttcagcagctgaaaacggtagttcagatatcaattgatcttgt
cgagcctttgggagtgttgagcgaatgtgacgaaccatggagccgttgttcgttgcattatcagccgtaacggcccatattgtcgcaagcaaagcgccat
ccattgctctcacgacatctagcaaattcctagcaagtcgctttccggtgtggggatattccaccctcgtaaaccccaatataactgagcgcatgttcca
catgtaatcgatccagtggattgtaacgaccatgtagcctctgttggcagcagatgtccacatatcagtagtcagggaagtgcgactcggtccaatatcg
tcgcgaatgaggcatgatagcattgttttacgcgtcagggccttttcttgtttccagcgagaaatgacacggcggcgaacagtttgacgacacggtaatt
tgtatgttggctgtagtgttgaacaaaacacgat