Description :
From Genome Similarity Track
Location :
contig_12:152934- 155952
Transcript NameFunction/comments
g3749.t1hypothetical protein
g3750.t1ETP44728.1 hypothetical protein F442_08733, partial [Phytophthora parasitica P10297

Sequence
3018 bases(100 bases per row)
AACTCAGAAGCTAATTTGCTGGCATGTCGATCTTCTCACTTGGTCATTCGGACGATCCTCTGCCGGTAGAAGTTGTCATGCAACGTGGCTGGACGTCCTC
CGTTCTTGTGAAACAGCATCTCCTCCTTATGCAGTCGGTCCATCTTGTCCAGATACACGGTCGCAGCATGGCACACCTTCCTCAACTCACTGCTGTCCAG
CTGCTCGGCCACTCGCTCCTCTCGACGCAGGATCCTCCTCGCGCGCTTGAACTTGCCCAGCTGCAGGGCGTTGTACATCAAGTTCACTCTGCACTTGCTC
TCCAGCACGGGGTCCTGGAGCCCCATGGAGATGCCGATCTGCAGCTTGGCCAGCAGCGTCGACTGGTTCAAATGGCGACACAGGAAGTGGCCGCCTCCTA
GCGTCGAAATGTACGCGTTGGCCGTGACCAGCGCCACCACCGCATTGACCAGCTTGACGGCGCGCCTCGCTGATGCCATGTACAATGGCAGGAGCTGCGT
GGGTCTGTACGTAACCAGCACCAGCACTCGACGAGTGTCTTGAGGGCTCTCCGCCACGAGGTAGCGAGCGGTGGCGTCCTCCCAGTGGATAATGTTCTTC
TGGTTGGTCTTCAAACTGATTCTCTCCACCAACAGCCTCGAAAGCTGCTGTGTCTCCTCCGGATACATGCAGAGCCCTCATCCGATAGTAGAAAGGTCAC
AAACTGGAAAACCTCCGCGTCTGCGATGGCTACAGAGCCGCAACACACGGAAATTATATGGGGAGAAGTGCAACATTTGTGTGTGAAGCCACGGTACGTT
TCAATGCGCGCAAGGCTCTGCGCTCCTGCAGCGGCGCCTCGAAGGCCACGACGCTCAGGCGGACACCCAGTGCAACACCCGTCATCTTCCGAAATGGATG
CATGTGATCGGATTGGATGTAAAGAAGTTCATTAATAGCCAATCGGAGACAGATGCATCTTGAAGCGACGCGTGCGTTTGGCTCGGATATCCTCATCGGC
CATGTCGCTCTTCCAGGTGCGCGAGTGGTGGGCCGCCAAGGGCGAGAATGACGAGGAGTATACTTCAGGGGCGCTGGTCGTGGGCAACGTGGACAACGAC
GCGTCTGGCCATGGTAAAGTGCGAATTGTTGCAACTGTGGGGGGTCTCGTCCGCTGACTGCGACACACATTCCTACAGCGAAGATCGTGACGGGCAGTTT
GAACGGCGTGTTGCGCGTATATTGCCCCACGCAGAGCGACTTCCGCATCGAGCATTTGCTGCTCGAAGAGAACCTCCGCCGCCCGATTCTGCAGTTGGCG
CTGGGCTACTTTATCCCGTGAGTCTGGTGGCCTCACGTGCAGTGGATGAAACAGTATAGCTGATTTTGTGTTCTGTACGGCAGGAACCAACGCATCTTGG
CGCTGGCCATTCTACAGCCGAGGAGGATTGGGGTCTATGTGGTGGAAGGCATGGGCGGGACGGGGATGGCGGCGAGTTACTTCAAGATCACACTACGATA
CGAACACCTGTTGGGGATCGATGGCGAGCATTTTACAGCGTACAACTTCATTTACGGGCCGTTTGGGTCAGCCAGCTCGAGCTCTGGCGGAGCAGCTCCT
GCACGCTTGGAGAAAGATCATTTGTGCGTGCAGTCGCTGGATGGGCGGCTTCAGTTTTTCGAGCAGGACCGATTCGCATTCCTGCAGCCACTCAACAACA
ATTTCTTGCCGGGCGCGATATGCTATGCGGCTGGCATGGACGCAGTTATAGCAGCCACGTCAGACTTGCAACTTGAGTGCTACCGTTACCAAGTCTTGGC
CTCTGCCTCGCTAAAGAAGAAGAAGAACGCGCTGGATGAAGACGGTAAAGAAGACCGACAAGGGGATGCCTCGTCGGCGTCCGTACACTGCGATTGGAAG
ATTAATATTGGTGAAATCATTGTGGATGTTCGAGTGGCGCGAACTTCATACCAGGACTCGGCAACCAGCTTTGACATTCTGGTTCTTGGAGAATTCACGC
TTTTTGGTATCAAACCCCAAGGAGAGGTATATCTGCAGAAGCGACTAGGCTTTCACCCATCGGCATTTTGTCCGTTCCAGCGCTGGGCATCACCTACCGA
GCGGGGTACACCAAACACCACTGCGCTGGAAAACCTGCTCGTTGCCAGCGACACGAAACTGTGGAGTGTCTTCAAGGACAAAACACTCATTTGGTCTGCT
TGTTCCTCGGTGGTTCCCGTGGCCCTCCAGGTCCGAATTTGGCGGCATAGATGGAATGATCGTGAGCCTCGACTCGGATGGAGCGCTTTCTGTGAATTAT
ATGGGTACAGATCCGCCGTCCTCCGCTGTTGTTGCACCAGACACAAAGGAAATCAACTATGAAGAGATGGATGAGGAACACCCACAGCTACTGAATGTCA
TTCGACGTGCACAAGGCGAGCGACGGACGGAGCCGAAGGATCGTGTGTTGATCCGAGCCCAGGTGCCTGCAATACTGGATGCACTACCGGATCGGAGCGA
CGAGTTTAGTCGTGGAGGCGGGAGCCCCGTACATGATGGCAAGAATACACAGCTGACGATGCGCGTGTACGTCACGTACACGGGTGCCAACCGTGTGTCC
AATGTGACGCTATCGGTGTTGACTCCCGAAAATGTGGCGGCTAGTGACTCCTCCTTCGTGATCGGGAGTATCGATGGCAAGGCATCTACGCCGCTCATCA
TTCCGGTTGTATTGCGCCCAAGTGCTGAAGCAATGCCAACCTCGTTATCCGTTACCATTTCAGCATCCTACACACTCGAGACAGGGCAGCCTCGTGTCTC
TCAGTGTGTTGTGAAGTTGCCCATGTGCATGGCGTGCCGCCTCGTGCCTCCCGTCAAGTCGAGCACCTTTAAATTCACCCTCGAGACTAATCAAGAGCCG
CTGGAACTTGCTAGCCTGTTCGAAGACATGCTTCACCAGCCAAGTTGCACGCCTGAGTGGGCAAAACAAGTGGTGGCGGGAGGATCCGGTACAAACGTGC
TGAGCTTCCAGTACTACA