Description :
From Genome Similarity Track
Location :
contig_12:152923- 155941
Transcript NameFunction/comments
g3927.t1hypothetical protein
g3928.t1ETP44728.1 hypothetical protein F442_08733, partial [Phytophthora parasitica P10297

Sequence
3018 bases(100 bases per row)
TAGTAAACTCAGAAGCTAATTTGCTGGCATGTCGATCTTCTCACTTGGTCATTCGGACGATCCTCTGCCGGTAGAAGTTGTCATGCAACGTGGCTGGACG
TCCTCCATTCTTGTGAAACAGCATCTCCTCCTTATGCAGTCGGTCCATCTTGTCCAGATACACGGTCGCAGCATGGCACACCTTCCTCAACTCACTGCTG
TCCAGCTGCTCGGCCACTCGCTCCTCTCGACGCAGGATCCTCCTCGCGCGCTTGAACTTGCCCAGCTGCAGGGCGTTGTACATCAAGTTCACTCTGCACT
TGCTCTCCAGCACGGGGTCCTGGAGCCCCATGGAGATGCCGATCTGCAGCTTGGCCAGCAGCGTCGACTGGTTCAAATGGCGACACAGGAAGTGGCCGCC
TCCTAGCGTCGAAATGTACGCGTTGGCCGTGACCAGCGCCACCACCGCATTGACCAGCTTGACGGCGCGCCTCGCTGATGCCATGTACAATGGCAGGAGC
TGCGTGGGTCTGTACGTAACCAGCACCAGCACTCGACGAGTGTCTTGAGGGCTCTCCGCCACGAGGTAGCGAGCGGTGGCGTCCTCCCAGTGGATAATGT
TCTTCTGGTTGGTCTTCAAACTGATTCTCTCCACCAACAGCCTCGAAAGCTGCTGTGTCTCCTCCGGATACATGCAGAGCCCTCATCCGATAGTAGAAAG
GTCACAAACTGGAAAACCTCCGCGTCTGCGATGGCTACAGAGCCGCAACACACGGAAATTATATGGGGAGAAGTGCAACATTTGTGTGTGAAGCCACGGT
ACGTTTCAATGCGCGCAAGGCTCTGCGCTCCTGCAGCGGCGCCTCGAAGGCCACGACGCTCAGGCGGACACCCAGTGCAACACCCGTCATCTTCCGAAAT
GGATGCATGTGATCGGATTGGATGTAAAGAAGTTCATTAATAGCCAATCGGAGACAGATGCATCTTGAAGCGACGCGTGCGTTTGGCTCGGATATCCTCA
TCGGCCATGTCGCTCTTCCAGGTGCGCGAGTGGTGGGCCGCCAAGGGCGAGAATGACGAGGAGTATACTTCAGGGGCGCTGGTCGTGGGCAACGTGGACA
ACGACGCGTCTGGCCATGGTAAAGTGCGAATTGTTGCAACTGTGGGGGGTCTCGTCCGCTGACTGCGACACACATTCCTACAGCGAAGATCGTGACGGGC
AGTTTGAACGGCGTGTTGCGCGTATATTGCCCCACGCAGAGCGACTTCCGCATCGAGCATTTGCTGCTCGAAGAGAACCTCCGCCGCCCGATTCTGCAGT
TGGCGCTGGGCTACTTTATCCCGTGAGTCTGGTGGCCTCACGTGCAGTGGATGAAACAGTATAGCTGATTTTGTGTTCTGTACGGCAGGAACCAACGCAT
CTTGGCGCTGGCCATTCTACAGCCGAGGAGGATTGGGGTCTATGTGGTGGAAGGCATGGGCGGGACGGGGATGGCGGCGAGTTACTTCAAGATCACACTA
CGATACGAACACCTGTTGGGGATCGATGGCGAGCATTTTACAGCGTACAACTTCATTTACGGGCCGTTTGGGTCAGCCAGCTCGAGCTCTGGCGGAGCAG
CTCCTGCACGCTTGGAGAAAGATCATTTGTGCGTGCAGTCGCTGGATGGGCGGCTTCAGTTTTTCGAGCAGGACCGATTCGCATTCCTGCAGCCACTCAA
CAACAATTTCTTGCCGGGCGCGATATGCTATGCGGCTGGCATGGACGCAGTTATAGCAGCCACGTCAGACTTGCAACTTGAGTGCTACCGTTACCAAGTC
TTGGCCTCCGCCTCGCTAAAGAAGAAGAAGAACGCGCTGGATGAAGACGGTAAAGAAGACCGACAAGGGGATGCCTCGTCGGCGTCCGTACACTGCGATT
GGAAGATTAATATTGGTGAAATCATTGTGGATGTTCGAGTGGCGCGAACTTCATACCAGGACTCGGCAACCAGCTTTGACATTCTGGTTCTTGGAGAATT
CACGCTTTTTGGTATCAAACCCCAAGGAGAGGTATATCTGCAGAAGCGACTAGGCTTTCACCCATCGGCATTTTGTCCGTTCCAGCGCTGGGCATCACCT
ACCGAGCGGGGTACACCAAACACCACTGCGCTGGAAAACCTGCTCGTTGCCAGCGATACGAAACTGTGGAGTGTCTTCAAGGACAAAACACTCATTTGGT
CTGCTTGTTCCTCGGTGGTTCCCGTGGCCCTCCAGGTCCGAATTTGGCGGCATAGATGGAATGATCGTGAGCCTCGACTCGGATGGAGCGCTTTCTGTGA
ATTATATGGGTACAGATCCGCCGTCCTCCGCTGTTGTTGCACCAGACACAAAGGAAATCAACTATGAAGAGATGGATGAGGAACACCCACAGCTACTGAA
TGTCATTCGACGTGCACAAGGCGAGCGACGGACGGAGCCAAAGGATCGTGTGTTGATCCGAGCCCAGGTGCCTGCAATACTGGATGCACTACCGGATCGG
AGCGACGAGTTTAGTCGTGGAGGCGGGAGCCCCGTACATGATGGCAAGAATACACAGCTGACGATGCGCGTGTACGTCACGTACACGGGTGCCAACCGTG
TGTCCAATGTGACGCTATCGGTGTTGACTCCCGAAAATGTGGCGGCTAGTGACTCCTCCTTCGTGATCGGGAGTATCGATGGCAAGGCATCTACGCCGCT
CATCATTCCGGTTGTATTGCGCCCAAGTGCTGAAGCAATGCCAACCTCGTTATCCGTTACCATTTCAGCATCCTACACACTCGAGACAGGGCAGCCTCGT
GTCTCTCAGTGTGTTGTGAAGTTGCCCATGTGCATGGCGTGCCGCCTCGTGCCTCCCGTCAAGTCGAGCACCTTTAAATTCACCCTCGAGACTAATCAAG
AGCCGCTGGAACTTGCTAGCCTGTTCGAAGACATGCTTCACCAGCCAAGTTGCACGCCTGAGTGGGCAAAACAAGTGGTGGCGGGAGGATCCGGTACAAA
CGTGCTGAGCTTCCAGTA