Description :
From Genome Similarity Track
Location :
Scaffold_99:152916- 154889
Transcript NameFunction/comments
g17995.t1hypothetical protein

Sequence
1973 bases(100 bases per row)
TCCCAGACAAGATCCCTGCGGAGCTGCCAGCGGATCGCGGAGTGCGCCACGAGATTGACCTCGTGCCTGGATCGAAGTACTGCGTGACGCGGCAGTGGTC
ACTGCCGCGCGATCAAGTCAAGGCCATCGACGACTTCTTCGAAGGCCGCCGCCAAGCCGGTCACGTCCGTGAGAGCATCTCGCCTCACTCGAGCCCGACC
TTCTGTGTGAAGAAGGCTACTGGCGGGGGGCGCATCGTACACGCCTTTAACAAGTTGAACGATGCCACCATCCCGGCGCAGACACCGATCCCGCGGAAGG
ACATGGTACTGGACTCCATGTCGGGCAGCGTCATTTACAGTGCCATCGACTTGACCGATGGCTTCTATCAGATCCTCATGAGAGAGAGCGATGTACCTCT
CACGGCAGTCAGTACGCCCAGCGGTATGCTCTGGGAGTGGCTCGTGATGCCCCAAGGTCTGAAGAACGCACCAGCCACATTTAATCGCATGGTGTCCCAT
GTGCTACGCCCGCTTCGTGACTTCGCTCCGAGTTACTTCGATGACATTTTTGTGCACAGTCACGCTGAAGAGGGTCTCAGCGCGATCGACGTGCATCTGC
GTCACTTGAGGCAGGTCTTTCAAGTGATGAGAGAGAACAAGCTCTACGCGAATCTCAAGAAGTGTGTCTTCTGCGCGCCGGAAATTCCGGTGCTTGGGTG
CTACGTAAGCAAAAACGGAGTCCGTGCTGACCCGGAAAAAGTGTCGTCTATTTGCTCGTGGCCACCACCATCAAACCCCACTGAGCTGCGTCAGTGGTTG
GGCCTCGCTAACTACTTGCACAAGTATACGAAGGGATATGCCGGCTTGATACAGCCACTGTCGTCGCTGTTGAAGAAAGACGCCACGTGGTCGTGGCGCC
CCGAGCATCAAGTAGCCTTCGACTCGGTGAAGAAGAGCTTGGCCTCGGCGCCAATACTGATGCTCCCAGATGACGCGAAACCGTTCCACGTCGTCTGCGA
CGCTAGCGACTTTGCTATCGGGTGCGCGCTCATGCAGTTTGACAACGAAGGCTGCGAACGAGTCGTGAGTTATCAATCACGACAGATGAAGCCGGCCGAA
CGCAACTATCCCGTCCACGATAAGGAACTTCTTGCGATGCGATACGCTCTGATCAAATTCAGAGTGTATCTGCTCGGAGAACAGACGTTCGCGGTGTACA
CGGATCACGCATCGCTGCGCACAGCGATGAAGTCCCCACATCTGTCTCAACGCATGGCACGATGGTTGTCGTTCGTCGTTCGCTGAGTACAACTTCGTCG
TGCACTACAAGCCCGGCAAGAACAATATCCTCGCCGATGCTCTGTCTCGGCGTCCAGACTATGATCCACGAGCAACGCGGGGTCGTCAAGTGATTGACGA
AGACGAGGATGACGAAGATCACTGTGCGATGTGCTTGACATCAGGTGTCAACCTGATGAACGTGACTCCAGAAATGCCGCTACGCGAAGAAATCGTCGTT
GCGTACAACGACGACGCAGTATATGCCGCCATCCTCGCACATCTTCTTTCCCCCAGTGATAAAACACTCCGCGCGCTGCCGAACAACACGCGCAATCAGA
TTAACCGATATCAACTCGACGGCGATCTGCTGACGTACAGCATCGATCGATTCGATGCTCCCCGCATCGCCATCCCGAACGACGATGATCTGCGCGCTCG
GATCATCCACGAGTTCCACGACAGCCCTGTCGGTGGTCACTTGGGCCGCGAAAAGACGTTCGCGGCAGTATCCCGCGACTTCTACTGGCCCCACATGTAC
AAATGGGTGCGCAAGTGGGTCCGTACTTGTGAGATTTGCCAGCGCGTGAAGCCGTCAAAGTCGTCCCAGGCTCCCCTGCGACCCCTGCCGATTGCAACTG
AGGCGTGGCGCTCAGTGTCGATGGACTTCATCTTCGGGCTTCCACCCGATGCCGACGGTCGGACTGGCGTCTT