Description :
From Genome Similarity Track
Location :
Scaffold_1173:1529- 5809
Sequence
4280 bases(100 bases per row)
GCGTGAAGGAGAAGGATGTCGCCTTTGCGCAGCTACTGCAGTCAAGCATCACGAGCTTCGTTGACCTGGAAGACTCGCTCGCGCCGGTGGCGCCTCCAAA
CAAGGGTTCCCCGACTATTCGAATGGACCCGGCGTTGCTGTACGCCAGGCTTTCCCGTAATTACAGCGGATTCGTCATGTCTTTTGACGGATCAGCGAAG
ACAGAGAAGTACGGTGGCTACGGGAGTTGTTCATGGGTGCTGTGGAGCCTTCCTGAGTGGAAGGTAGTGATTGCTGCAAACGCTTACCTCTCGGCTACCA
CGGTGAATGAGGCAGAGTATACAGGTATGATAAACGGTGTCAAGGCTGCTATTGCGCACGGTACCGAGGATTTAGTCATCGTTGGGGACTCAAGGCTCGC
GATTCAACAATCACTAGGGGTGATCGCATGCAGGAAGGAAACTTTGCTAGCGCTGCTGAATACTCACAAGGAACTCGCGGCCAAGCTTCGATCAGTTAAA
TATCTTCACGTTGTACGAGAATACAACGCGGCCGCGGATTCGTTAGCCACTGAAGCGCTGGAATCAAAGGTCAGTCGGGTAATCTTGGCTGAAAGTCGCA
AGTCGGAATCGGCATCGCTGAACCGCATCCAGGAAATGATCTACGAGCCGGATGAAGACTGGGTAGATGTTTCGTCACAAGGAGCAGAGCGTCAAGTACA
TGTACTGTCAGGCAGCGAGTCTTCAAAGTGGAAAACTTTCGAAAATTTCGTGGTTGATTACAGCTCACCAGAGTGTGATTATGGCAATATAGCAGTGATG
ACTCGGCGACAGACGAAATCCAAGAAACGCGTCAGGTTTGCAGATGAACACTCGGAGGATGTCTCAAAAGCTCAAGAGGAGCATGAAGAACGACGAGAGA
CGTCCACCGAAGATTCATTCGGCGAAGATTTGCCAGACCATCCTCACAAGACTGTACCATCGGCATTTCCCGATGCGGAAGATGTTGATCCGGTAGAGAT
ACAGCAGGAACGACGCAGACGGATACTGGTGGCACAAGACGAGGAGCAGAAGTGGTTTAACATCAAGAAGGGGCTTCAGGGCCAAGCAGAAGAGCTGAGT
TACAAAGAAGCTCGAGATGCCTGGACCGGTTCGTATTGTCTGAAGACGGCGTGCTTCACTATCTTGGATTGAATCGTCGGTACGACCACGGTTGGCAAGA
GGAGACCAAGCTGCGGCTAGTAGTACCGACAACGATGATTCAAGAGGTCTTACAGAACTGTCACGACTCGCTGGAAGGAGGACATCAAGGTGTGGTGAGA
ACGTTCCATCGCGTTAAGTCCGATTATTATTGGACCGGCTTGTACGCTGACGTGGAGAAGCATGTGAAGTCATGTCCAGATTGCAGCTCGAGTAAAATCC
GTCCACAGTTTCGTGGATACTCACCTGGCAACGTACTAGCCGAACGACCTTTCCAGATCGTCTCGATGGATTTTGTGATCCCACTACCGAAATCTCGCAG
GGGCAACACGGCGTTGCTCCTATTTCAGTGCTCGTTCACGGGATTCGTTATTGCCAAGGCTATGTCAGATACGACTGCACTGAGTGTTGCCCAAGTGCTC
GAAGAATGTGTGTCCCACGGTTCGAAGCCCCATCACTGATAAGGCAAAACCGCGACCCACGCTTCAGGAGCGAAGTTTTCCAAGCATTTGCAGAGATGAT
GTAGTCAAGATCACGAGCGACTTTGAGCTATCGGCCACAGGCTAATGGACAGCAGGAACGCTCGGTGAAGTCGGTGATGGGTTCCGTACGGGTGTACGCG
GAAGACCCTCTACAGCAAGATTGGGACGAAATCGCGGAGAAGCTAGGATTTGCTATTAATACTTCTCAAGACACTACGAGGAAGGAAACGCCGTTCTACC
TCGTTCACGGTTGGGATGCTCAGTCGACGTTGAGGGCAATGTCGTCATCACTCAAACGAGGACTCGGCAAGCAGTCTGACGCACTGGCGTGGCGGCGCGA
GATCAATCGACAGCATGAGGTCGCCCTCACTATGGCCAAAGATTATCAGGCTGTAGAAAAGGAGCGACGAGCGAAAAAGCATAATGATGCTCTAAGTCGA
CTGGAAAAAGCCGCTGTACCTCAACCAAGTGGAAACGAACACTCGGCAGACCCTCTAGAAGCTTCAGAAGAGATGGAAGATCCTGCAAGAGCCCCACCGA
GATCTCTTTTCGAGATTGGGAGCCGGGCGTGGTTGTACATGGAACGCGTCAAACCGGGCTTGACGAAGAAATTAGCTCACCGATGGCATGGACCTTTTCG
GATCAAGCGCAAGGTGGAAGAGTTTGCGTACGAGCTGGAACTACCAGACCGAAGTGGGTATCGCTTCTACCCAGTAGTGCATGTGTCGAGACTCAAGGCT
GTCAACGAGTTCAACAGTCGACCGAGCACTCGGTTGGTACTAGACGCGACTAATGAAGCAAGACTCGACTTCGATGAGGAACTGTTGCCTGAGGACAGCT
GGGAACCGGATCAAGTTGCCGGTGAATATGAAGTCGAGGCCATCCTCGACGACAGAACACCACTGACGACGAGCACGGAGCGTGCTGTACGCGAGTTCAA
AGTCAAGTGGGTGGGCTATGAAGATACAACTTGGGAACCATCATCAAACTTGTCTTGTGGAGGTCTGCTGTACGACTATTTGCGAGCCAAGAAGAGCGAG
AATCGGCTGCAGATGGCGCAAGTGGCGGACGAAGACTAGCGTGACTGGATCACGTGTGAACTGGCCACAGGGCGATGCAGCCTGTGGTAACAGACGAAAA
ACGTTACTGCAACAACAAATTGTATATGCATTTGAAGAACAACATGGACATGATTACGCTGTGGAAGTGGATTAAGAATAAGAAAACATGAATGCCGACC
GGAGAGCGACCCCTGAAAGCGAAGTCACGCGGGATACCTCAACAGTTGGCTGAGATGCTGGAGAACGTCGTGGAACACGCAGCGAGGACATCATCGAAAC
CAACAGCAGTCTCGAGGCGACGCTGAGTGTGCATATCGCCGTGGAGAGGAGGCGCAACGCTGAGCTGCACTTGGTGACGAGCCATTGCAGTCAAGTACGG
GATTATCGAGGTCATCATGTGATCGACCGATGCCTCCGTACTTTCAGCCAGCATGGCGCGCAGCGAATCTTCGGTGAGTGGTGGTGGACCACCAGCTGGG
GCGAAAGGAGCAGCAGGAGCCATCTCCGCGGATTCAGCGACGACGGGGAGTGCTGCAGGAGCTACCGCAGGGAGTGAAGAGTCCAGGGCAGGAAGCGCCG
AAGGACCAGTTGATGACGACGCTGTCGGAGGAAGTGTAGCAGACTGAGGGACGTTCGAACCCTCGGTCTTGCCCTCCTGAGAAACAAGTCGAGTAATGCG
AGGTGATGAGCAAGGTGCCGATGATTCAAGAGAAGGATGAGCTGACGTACCTCCAGCTGTTCACGTTCGCGACGTCTACGAGGATTGAGACGCTGAAAAG
CGTCGGACACGGCTTGATTCAGACGCTTGGACATACGGTGGCGAGATGGTGAATTGAAGAATGAAGAAATGTCACAACGGGCACCAGTACCGTGGCTTCC
ATTGCGACAGGGGCAGTTGTGGTGTAGTGATTTCTCCGTAGTTGCGGATTATCACCCGTCGACAAAGACGTGACACCGCCCAAGTTGTTCAAGCGACGAA
CCCTCGGTCAGGTGATGTACGGAGACGCCAAGGTGCAAGGGACTCGACGGCGTCACCTCCGAGTTTTCAACAAGTATCGGATACGGCCCTATGTCACTGA
ATCCAGGCTGTCCTTATTATTAATAATGGACTGGCCGGATTCGCATTCAGCGGACCATCTACGGTACGAACCCTCAGTGGCGGTTGGGATGAGTTCGCGG
AATACTCAGCGACCTTTGGAAGACACGTTCACCGTCTGGGACAGGGCGCGGACCGTTAAAGATGCTCATGCGACGGTGCAGACGACGCTTGGCATGCAAG
AAGATCCATAACGGATCATTGTTCACTTGATATTTGTATACTTGATTAGGACTTCTTATTAGGAATAGACCCGAAAGGGTAAGCTTAAATACAGAACAGA
ATTTCCACTCAAGCACACAGAGCGACGTCCGGCTTCAAGGTAAGCGTCAGGTCAAGCTTGTTTGAGTGTGTTATGCCTGTCGGTGAACTCGAAGCTCTGT
AGCGAGGGTTCATTTGGCAAGGCCAAGAGGCTTTGTGTATTGGCCGATTATTATCGGGAGGTTTTACGTGACGGCTTATT