Description :
From Genome Similarity Track
Location :
Scaffold_9:1528983- 1530059
Sequence
1076 bases(100 bases per row)
CGTTCGCGGCCTTCATCGTCGGCCTGCAATAGCGCATAGCCAATTGCGTAGTCAGACGCATCACAGACTACGCTGAAAGGCTTCGTCTCGTCCGGCAATG
CCAGGACTGGCGCGCGCTGTAAGCTCGCTTTGATGTCGTTAAAAGCATCTTGATGGCGACGCTCCTAGCGCCAGTCGACATCCTTCTTCAGGAGATCCGA
CAAGGGCCGTGCCAGCTCGGCGTAGCCTGCACTATACTTGTGCAGGTAGTTGGCGAGGCCCAACCACTGTCGTAGGTCCTTCTGCGACCGAGGTGGCGGC
CAAGCCGCGATGGTTTTCACCTTCTCTGGGTCCGCCCGGACCCCGGCGCTGCTGACGAAGCAGCCCAGGACCTTGATCTCCTCAGCTGCGAACACACACT
TGTCGATGTTGGCGTACAGCTTGTTCGCCCGCATGACTTCGAACACACGTCGAAGGTGCTGGAGATGCACCTCCATGGCCGTCTGGCATGCCTCGGCACG
GCTGTGGACGAAGATGTCGTCAAAGTACGTCTGTGTGAACGCACGCAAAGGTCGGAACAGTTGTGTGACTAAGCGATTGAACGTTGCCTGGGCGTTAGAA
AGCCCCTGTGGCATGACCAGCCACTCCCAGAGCATACCGCTCGGCGTGCTCACAGCCGTGAGTGGGATGTCACTCTCGCGCATCAAGATCTGGTAGTATC
CGTCCACCAGGTCCAGCGCGCTATACAGCATGCAGCCGGCCATGTTGTTGAGCAACACGTCCTTGCGCGGGATCGGTGTCTGCGCAGGCACTGTCGCGCT
GTTCAGCTTGTTATAAGCATGAACCAGACGCCACTTTCCGTTCGGTTTGCGAACACAGAAGGTAGGCGTCGAGTGCGGGGACTTCGACTCCCGCACCATG
CCTGCCTCCGCCTTGGCGGCAAAGAAGGCATCAATGACTTCACACTGCTCCCGGGGAAGAGGCCATTGCCTCGTGACGTAGTACTTCGTGCCCGGCACGA
TATCGATCTCGTGCCTGATTCCCCTGTCCGGAGGGAGATTGGACGGTGGATCCTTGGACACCACGTCCTCAAACTC