Description :
From Genome Similarity Track
Location :
Scaffold_785:15285- 17571
Transcript NameFunction/comments
Phyta_totarag10712hypothetical protein PHYSODRAFT_508340

Sequence
2286 bases(100 bases per row)
GTTCGACgcgttggagctgcttggGCCGTCGCTGTCCGAAGTGCTGACGTTCGTAACCCCGCCGCAACCTCGTCAAATCCAGCAGGAGACGCAGCAAGAG
GCTGAGGAAGCTACGAACGGAGGCGAACTGACGGCCGGGGACAACCAGTCGCAGCACGGcagtagctccagctcaCTGGGCGAGGCCCAGGCGTCcgcca
agttcgacttgCGGCTCTCTAGATCCGCGGTACTGGGCAAGCTGGCGGATCCATCCATTGACAACGCGCGCAAGACGCAGGAGTActtcgccaagctgct
gagcaagatCCAGTGCGAGGCGACGGGCctcgtgttgctgcacgATGCGACGGTCGTGATCTTCCTGGAGACGACGGCCGAGCAGTTCGTGGCTATCCTT
aagcagcttcggcagcaaCGCATCATCGACGCGAGCTCCATGAAGATCCTGGCCAACTGTGATGACCATGGATCGAGGATTCTGCAAGGGCTGTACTTTA
AGAAGATCGTGATCAACCGCAGCGATGCAGGCGAGTGGACGGACGACTCGGCTCCGCAATGCGTTGTGGAGACGTTCCTCAACCTCATCAAGTTTATCAA
GAAAATCGGACCGATGCCACCCGGAGAAATCCGCAAGTGTCTGACGAATCTCTCGAACACGGACCAGACCTTCCTACCGTCCAACGACCtcgtgctgtgg
ctgctcaGTAGAGAAGAGCTCATGACTCTTGATGAGTATCTTCTCTTTTTCGACGAACCGGTGGCCGTCCAGCTAGAGTCCGAGCGTGTGTGGCCCGTGC
ACCCCCTTATCCACTACTAGCAGTGAAAAATAGGCTATTGATGAGCAAAGTTACTACCGGTTGAATTTCATCGCCGTAAGGTTGATGTGGTTTGTTTGAT
TATGCAGATGCTATGCGGGCTCACCCAATTACTGCAAACCTCTGGTCAGGATTGTGTTGAGGACTTCGCGCTGGGTCTTGTAATCGTCGTAAACGTTCAA
ATTCAGAATCTGCTAATTCGTAATCCCATTTTTTTCCCTTACATCCGCCATCAAGCACGTTAAACAAGAGAATGCCAAACAATTGACTGCTATCGAAGAA
GCGTCGACACGGGGCAAATATAAAACCTAAGCTTAGTAGCAGTATTGCACCTAGTCCGACGTTATTCAAGACGAGGTCGCTGATGATCTTGTACTGCGTA
GTACTTGAGGAGGAACCTTTCACCTTTGCCATTTTGGAATTCACCACCAACGACGCACTACCGTTCCACCACTTTCACTTCACCGTCACCATGTCTCCTG
CTATGACCAAGAGCTCCTCGCATGACCTACCGTTTCCTCGGCAACTCCGGCCTGCTCGTCTCGAAACTCGGTCTAGGCAGCTGGGTCGACGTCAGCGAAC
AGTACACGGCTGACCACTGGTACGAGATGATGGTTCTCGCGTTTTAGCACGGTGCCAACCTCTTCGACAACGTCGAGACGTATGGAGACGGTCTGGCTGA
GAAGAACATGTCGGCTATCAAGAAGGGAATCGCCGAAGATGTCTGGACTCGAGAGGACGTCATGATCACCACGGAAATCTTTTTCTGGGTGAAACGCGTT
GACCTTGTGGGTCCGAACTCCTGTGGTCTCACCCGCATGCACATCGTCGAAGGAATGAAGGCGTCGCTCAAGCGGCTGCAATCGATTACGTTGATATTAT
CTTCTGCCACCAGCCGGACCCGCACACGCCCATCGAGGAGACAGTTTGGGCAATGAACTTTGTGATTCAGCAATGCTGGGCCTGCTACTGGGGAACGAGC
TCGTGGAGTGCTGCCATCATTGTCGAGGCGTGTGAGATCGCTGACCACTTGGGCTTGATTCGCCCCATTGTGGAGCAGCCAGGGTACAGCTTGCTGGAGC
CTACCTGAGAAGTACAAGTCGGCGAATCTGACGACGTGGTCTTCCCTTGCGTTTGGTATTCTGACGGGCAAGTACAGCGCTGGCACGCCCGACGGCTCCC
GGATGGAGAACCCGTTCTACAAGTCGTTCGTGTCCGATTTCGCTGGTCACGCTGGGACCCATTGCCGAGAAGCTGGGCAATGACCAGGGCCCAACTTGCT
CTCGCCTGATGCGTTAGCAATGATAACATCTCCACCGTGCTGATAGGTGCCAAGACTGCCGACCAACTGAAAGACAACTTGAAGGTTTTGGGAATGCTGG
ACAAGTTGATTCCTGAAGTGAAGGCTGAGATTGACGTACTTGTACCATTTGATGCTGAGTTGGCCAAGCCGTTGGGATCCTCCGCC