Description :
From Genome Similarity Track
Location :
Scaffold_334:15284- 17711
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_334-fgenesh-gene-0.4Conserved gene of unknown function

Sequence
2427 bases(100 bases per row)
TGCTGGAGATCATCCGCAGGGCATCGAACCCTCGCGCGATGCTCTTCCAGCGAACGCAGACGGAGCCGTGCGACATCGTCCCGCACTCGAAGAACGATAA
GAAAAAGAAGACGAATGGGAAAATGTACGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTCAAGC
GGAAGCAGAAACTCGTGCATCCAAACTCGTTCTGCGACGGCTGCGGTATGGACCCGATCACTGGCGCATTGTGGACCTGCAGTGTGTGCCCGAATTATAA
TTTATGCTCGGACTGCTACAACTTTGGCACGCATGGGCTCGAGAACACCGAGTCGATGCAGGCGCTGAACGAAGCGATCGTGCAGGATAAGCTGCAGCGC
AAGTGCAAGCGGTTCACGCAGGAGTTTTTGATGTCACTGCGCCGCGATATCTGCAAAGGACGGCCCGACAAGTTTGAGTATATGGGCAGCTGGATCGCCG
ACATCGTGATTGGGACAGCGGCGAGCAAGATCACGGTGCGTGGCATCGAGATCCCGTCGTTGACGCCCATNNNNNNNNNNNNNNNNNNNNNNNNNNGCAG
CGGTTCGTGTCGAACCTCATGCCGCTGGTGTCGAATCGCACGGACATTGAGATCAATATCGAGTGGCTGCCAGACGACTCGGAGCGCGCGAGCGTCGACA
TTGAGGACATCCACGCATTAGGCGCGCCGGACCACGAGGAGCTCGAGAAGCTCCGGATCTGGATCTCGGACAAGAAGACGCGCACGACGTCTCCGTTTGC
GTAAGGCTCATGTCCATATAGGAAAGTAGTTAGAGAAGAAGAAGACGAGCAACAAGCAGCAGTAAGTAGATAGCAGAGGAGGAGGAGAGGAGAGAAGAGA
AGAGCACATGCGCATGCGAAAAACGCAGTGGCAGATGAATATATGTACCCCCATATATGGCGGAGAACATGATTGACTAGTGTGGCTTCATTCTGTTGCA
CACGGTAGATACCGGTATAAATAAGTTTCATATCGGTTACTTTGTCGGCATACTGTTTTAGATCGACGCATGTTTTTAACAAAATGCACGTGACTGTTAG
GTTTCAAAAAACCCTTTGACACGTGATATTGTATGCAAAGAGAGAGGTCCTGCGCTTCTCCACCATTGATGCCGTCGAGCCCCAATCGCGCAAGACAAAA
GACCTCCCGACCCGCACAACATGTTGGCCGCGTTCCGCTCGCTCTCGCTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTCGAGCCCCGCGTTCCTGCAGTTCTCCACCAGCACCACGGAGACGTCGAGTGATGAGGACGCGACCGCGGCGTTCCTGGACGCGACGGCGCCGTC
CGAGTTCCGCGTTGTCAAGACCATGAAGAAGGACATCCGTGGCAGCCCGCGCAAGCTGACGTACCTGGCCCAACAGATCCGCGGGCTCCCAGCGCAGGAA
GCGATCCTGCAGATGAAGTTCTCACCCAAGAGAAAAGCGGCGATCGTGCAAAAGACCGTGCAGAACGCGATCAATCTGGCCNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNGATTGAACCGGAGAACCTCCAAGTCGCCGAGTGCTTTGTGAACAAAGGACACTACCTGAAGCGCCTGCGCATCATGG
GTCGAGGTGCGTTTCTTTTTTCTCCTTTATATTATGACAACAACATGCTGGGCATGTAGAACAATGTGGATCTCTGACATATTGCTGTCGTGTGTTTATG
TATCTGCTTTTAGGCCGCTCTGGTATCATGCACCACCCACACACGCACTTGACTGTCGTGCTCCGCGAATTCGACCCGTCGAAGAAGCCATTGAACCGCT
TCTTGACCAAGAAGCTCGCGCGCGAGACTGCGGCGGCTGCCAAGACCGACAAGCACGATGAATAGAGCCTCACCGCACGCCGTTTGTGATTTTAGCCTTT
TCTTGTTGGGCTTTTTTCCCACTGCGTTGTTCTCAACGTGAGCCATCATTCACATTGATTCCACATGCTGTTGTTTCGCCAAGGAGAGGGATCTTGGTTT
GCTCAGGATCTGCACAGGAACAATGAGGATCATATTGAGGTAAGGGCTTTGCGCGCCATCGCGTGATTCCATTTCTCCTCACTGAAGATTGGAGCATTCG
CTATTATGTTGGCAAGCACATGCTCTCGACACTTCCACGGCATCTTGATCGTCAGCGAAAATCCCAAGAGTTTGTACCCCTTTGTGCTGCTTTGAGTTTC
TGTTGCTCTCGCTTTACATACTCATTGCAGGCATGCAACCTCATGGATGCAAAAGAATGAAACGAGCTACTGCTTTTATATCGTTCTCAATCGTGCCCGA
CGGTACACATGCACGCAAGTCTCACGC