Description :
From Genome Similarity Track
Location :
Scaffold_39:152834- 156785
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G012012Similar to ragA: Ras-related GTP-binding protein A (Dictyostelium discoideum)

Sequence
3951 bases(100 bases per row)
TGGTCAAAAATACTTTTGACGAACGCACTCGGTTGCTTACGTAGTCACGATGGCTCCACAACCACTCGGGTCAGACAAGGGACCTAGACGATCGCGATTT
CTCTTTGTGTGAAACACTCCCATCAGCTCATGCGTCTGTATGAGTGTTGCGGCGACACCCAGTCGAGAAGCAAGTCGACGGCAAATCTGTCATGCAACCT
TTCGATTTGTTCATCGCAAGAACCCTAGAAAGGGAACCCACACATTGAAACATGCTCAGTTTAGCCTCAAATTCAGTCGTGTTAGTTATGATGGTCGGCC
AAAGCTCGTCAAACCCCTTTAAGAGGGTGTTTTGCTTTCGATTCTCAACATTATGCCTGTACGAACAGGGTCAGTGACATGCTCGATCCGCCTGTCAAGC
ATTCACCATCGGTGCAGAACATTGAGAATTCTTGATTCTCCCGAACGGCGACCACGCAGCAAATGCTCGTGCTCTTGCACTCCATAGTGGTAACGCGCCC
ACTACGCTCTTGGATGCATTGGTGGATGCATTGGTCGTCGAGTTGGAGTTTGCACCTATACTGCCCCTCCGAATGGTTGCGATGGCAGAGATCCAAGTGA
ACTTGGTACATGCGCGCTATTAGACAGCGAATGCGTCCGTCTTGTCGCACAAAGAACGCGTGATCGTGCTTCAAACCGAGACGAGTGTCGACAGCTTTCC
AGCGCATGATCGTGATTGGTAATCCAATCAAAAGCGAGCTCTAGGATCAGCACACAGGGAAAAGTTGGCGGCTTCGACCAATCTTCGTTGCCACGAATGC
TGCGTTACTGCTTGAACGAGGCAACCTAGGATCGCAGGATCTCGAGCTCTTACTCTTGTTTCTTGATCGTCGCAGCCAGTTCAGCCATGGGGCTCGGAGG
AAGCAGCTTCATCGGGAAGACGAAGCGTCTCCGGACTGGGTTTTTCGTCGACGGATTCAGCCGAAAGATTAAATGCAAGTTCTCACACGCCGTGTAGGGG
TCATTATCGGTTGCTTGGCGTAGAAAGCGTGGCATGCTTAATTCTTCAGGAGAGACTAAATCGCGCTTTACTCTTGGGTTCCATTCCGCTCACTTGTTTT
GGCCTCAAGGCTTCGTTTCATGCACTGACAGCGTTACACAGTAGAAAGCGTCAGAAGACACATTCAAGGCTTTTTGGCCCATGCACAAGCCAAGTGCGTC
AGACGTTACCTGAGTAGCATACTCTTCGTTGACTGGCGTGTCCGCGTCCCATGCATGCACGCAAACGTGTATGTACACTTCGGGACCTTCCAATACCCTA
CCGGGTCAAAGTGACGCGGCAACGAGAAATGAAACGAAAAAAACAATGAAGCGATAGTCAAGCGTTGTATAAATAAAATAGTTCCTTACGATTGACGGAG
CTCTTGCAGTCTTCAAGCTAGAAGCGCCGCTGCCCGGTCGCTATCGTGGACTTGTAGTTGTACGTTGCGTCCGGAAGACGTGATGGGAACGTCACGGACC
CCTGCGAGATCTCGGCCACCCCATCTTCGTTGTTGTCGCTGGGCGCAATCGCTGATGCTGCTTCTGCTGCAGACATAGTCTCGCTGCTATTGGCGTATTG
GCGGTAGCGGTGCTTTCATCCTCGAGCTTCACGCGCTTCGGAGCTGGTGGCGACATCACGATCTCGAGCTTCCGACTTTTTAAATATCATGCCGCCTCTC
TGTGATCCTTCGGTTCAGATCCGGTGAGAGTGAGACGGAGGGGATCAGGTCGCACACCCTCAGTTTACGTGAATGATCCTTGTGAAAGCACGCAGTTTTT
TTCTTTGGCTTTGCTGGTTGATCCATCTCGAGGGTCTGGACAGCATTTCGACAACACTAATTGATCATGCACAACAGTTGACGAGGCTTGAATGTATTCA
TTCTTTCAAAAGTCGAACTGGTCGATCTGGAAACTGGACTGTGCTGTTNNNNNNNNNNNNNNNNNNNNTTGCTGCATGTAGTAGTTGTACCTGCAACTGG
GCTAATTTCAAAAGCGAAACAATATTGGCGGCGAATCTCTTGTAGTTAGGCCATGTCTCTCCTCTTCCATCGTCAAAAAAGGTGATCCTCTTTCTCTCTT
TCTTTCAGCGACATTGTGTTTATTGAGTTGTCATCCTTTCCAAACTTCACATGTGCTCAAAAGCAGCCATTCATAAAGCACATACCACTTCGCAAGCCGT
AACGCGAGTGTGCTGGCCCTCTTTTCCCTTTGCGGCACCTTTGTGTGCGTCGTCATTTAACTTGTTTGCTGAACGTAGCTTTCAAACACTGGTCTAGCAG
CCTTGATGTTAAGGTGGATCGTGGAAGGTTCTGTGGTAAAAGAGCAGCAACCCAACACAAAGGAGATAAATCACGTCAGTGCATCCCACCGGAGCAAAGG
AGCAATAAGCAAGTCAGAGGCATCGTACGGATGTTTTGGTCCGACATGATCACCATAATGTAGGTGTTGGTCGTAAAAAAGTCGATGAACGCCGTGAAGT
TCGAGTTGCGGACCTCCATGCCCTGGAATTGGGCCTGCGTCTTGCTGCAACTGAGCTTGAACTGCTTGATGATGTTACTGATCTTTTCGAATCGGTGAAT
GTCGCGGTGGTTCGCATGCGTGGCATGTGAGATTACGAGGAACGTCGCGCGCTCGAACAGCACGACTTCGTCGGCATTACAGATCGAACAGAACGTGTTC
AAGTGCTTCTCGAGGTCCTGCATGTTTGGGATCAGCGAGTACACGATCGATGACCACGCACGGTACAGAGTTTCATCCCAGATCGATGTGCCGAAGCACA
CCGTCGGCAACGCTCCAGTTCGAGCCAGAATCATCTCCTTCTTTTGCTCAAAAACCTGCATGTAGCAAGAAGTAATAACCATCATACACACGATATGAGC
TTTGTGCCCCAATGCATTCGATAAAACAAGGACGAAGTCCCACGTACGCGTTCCCGTTGCTCCTCTGGGACCAGATCCATCTTGTGGATGAGCACAAACA
CCTTGGCATTGCTCGAGTTTTGGTCAATCGCTTCCAAGCAACCGTCAAAGTGCGCCATATCTTTCTACAAGGGTCGTCGCGCCGAATCGTTCACATCAGT
ATACACAGAGCACAACGTCACTTCAACAAGCGGATGCATACGTACGTCGATTTCGCGGCTTTCAATGTCAAACACGTAAATTAGGAGCTCCACGCTGCGG
AAAATGTGGTCCCGCTGGCTTTCAAAGTAGTTCTCGTAGAACGCATCTTGCCTGTTGACAACAATACGCAGCGTAAAGAAAAAATCCACAGCATCAACAG
CAAAACGCGACAGATAGCGCCGTCACATACCCGCCGCAATCCCAGAGGTTCAACACCAGATTGCCCAGGAATCGCACATGCGAGTGCTCCACATCCACTG
TGTCGTACACAAGCAGCCGTATCGTCAGTAATCATCCCTCAAAAGCACCAGATCGATCTCATTTATATATTTGAGATATAGCATGGAACCTACGTACAGG
TTGGTCCGAGGCGCATGGTATCACGAGCTACGACGGCCAGCATCACAACAGTACATTAGATCCCACATCACATCCCAGATGAAGCACAGCACGACGAAAA
GGGCACAATAAAACTACCAACTACTATTACTGCGTCAATAAACGCCGCTGCCTAAGCAGCATATTGCTCGCTTTCGCTTACCGAGGTAGTTGGCGAAGAT
GATGGATCGCATCGACGTCTTGCCGGATCCGGACTTGCCCATCAACAGCACCTAATCACACACACAAATACAACAACATCATTTCAATATACATGCAATG
AGAGCGTTCACGAGACGCTTGTAGTGCGCATGAGGGCGTCGCACTTTCTTCTTCATCTTGGCTTCGTCGCTCGCTTCTTTCCCTTCTTTCTGCAATGGAT
GCACACACACACGGAATGCGCGCAATACACCCAGCAATTCATTTTTGAGTT