Description :
From Genome Similarity Track
Location :
Scaffold_237:15281- 19634
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_237-snap-gene-0.12TATA-binding-protein-associated factor 172

Sequence
4353 bases(100 bases per row)
TGAGTGTGGGCAGCAGCAGCTTCCTGTGCCTTGATGGCCGTCGAAGAGGTCTTTAGGAGATGGAGCACATTCGCTGTACTGGCGTTCATGCTCGTGGAGG
CTTCCGTGCTTGTGACGACCGTCTGCGCGACCTGTTCCTTGAACGCTTGTAGATCCATAATGTGCTCTTCCAGCGATGCTTCCATGATGAGACGAAACAC
GCGAACCGTTTTCTTCTGACCGATACGGTGCGCTCGGTCCATGGCCTGCAAATCCACAAACGGATTCCACGAGTGCTCGACAAAAATCACCGTGTCGGCG
CCCGTGAGGGTGAGCCCGAGACCGCCGACAGCGGTCGTGAGCAAGAGCAGATCGATGGACGGATCATCGTTGAATTTTGCAACAATGTCGTGGCGTTTGG
ACGAAGGGGTCTTGCCATCCAGCCGAAGAGACGTCACGCTTGGCAGTGCCTGCGCGAGCATGTCTTGGACCATATCGAGCGTCTCGGCCAGGTGCGCGAA
CACCAAACATCGATGGCTTCCCCGCTCCATGAAATCGCCGTTTTCTCGGCCCATGTCGCAAGACTCGACCAGCAGATCATGAAGACCAACCATCTTGCCC
GAGTGCTTCCAGTTCGACAGCGACTTCTGCTCAGCAGCTGAAGCTTCTGTCATCACGCTTTCCTCCTTGACGAGAGCCGGGTGCACACAAATCTTCTTTA
GCAGTTGTAGCTGACGCAGCACGCCGGGAAGCGGCCCGCCAGTCGCTTCGTTTCCGTCACTGTTGCTGGAAGCAGCCTTGTACAGACGCTGCTGCAGCGC
CGTGAGCGGCAGGAGGATGTTGGAGACGATCTTTGGCGGCAGTTCCTTGAGCACATCGTCCTTGGTGCGGCGTAAGATGAACGGAAGCACACGTTGATGT
AGCGTGTTGATGGCGTGCGCGGCAAGTTCTTTTTGCTTGGGGGTCGCATTTCGCTCTCGTGAACGCGAGATCGGGAGCTCAAAGTCGCGTCGAAACTCGA
CATAGTCGCCGAGATAACCGGGCATCAAGAAAGTGAAGAGCGCCCACAGGTCGCCGACGTGGTTTTGCAGGGGCGTACCGCTCAGCACGAATCGGTGGGA
TGCTTGGAGCGAGCACACGGCGTCAAACAGCGAGGACTTCGGATTGCGGATCAGGTGGGCTTCATCCAGCACGATGAATTCAAATGGGAAAGCCTTCAAG
ATCTCGCGGTCTGACCGCACAGCTGAGTATGTTGTCACTAGCAGCACCGCCCCGGTGGTGTTCTTACGAGCGGCTGCGAGCATCGCCTTGCGCTTGGCAG
CGGGCCCCGAGTAGTCGACCACGTCAGCGAAGACGGTTGGAAAGCAGTGCTTGGCCTCGGCGACCCAGTGGTGGACGATAATCGGCGGACACACGACCAG
CGAGAAGGACGAAGAGATCTTCTTCTTCGATACGGTTGTCGCCACCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGCACCGTCTTGCCGAG
GCCCATGTCATCAGCGAGCACGCCGCCCATTTGGTTATCGACCAGGAACTTCAGCCAGTTGACACCATGCTGTTGATAGTCGCGCAACGCAAACGACTCA
GCGAGAACGTCTCGAACGGATACCGAGGCGATGGCTTTGCCCTGGAGCAAGCTTTCCAAGAACGCTCGTGAGGACTGGTTCTCTTGAAGCACCTGCTGAA
GCTGTGGGTGGCATTGTCCTTCCACACCGGTGAGGTCCATTTGCAGTGGCATGAGTGGTAGCAGATCGGCAAACGCCTTTGCAGCCATTGACCTTACGCT
CGAATCGGCGGCATGCATGGCCCGCATGGCGAAGTGAAGGAAGCTGGGCACGAACGCAGTCAGTTGGGCACCCATCTCGACCACCAGCCGATCCAACACC
ATGATGGAGCCTGCCAGACGATGATGTCGAGATTTTACGGACAGCGTGTTGGGCAGGTCACTGTCTTGGGAGTCTCGTGCTGAGAACAGCCTTCGATATA
GAATGATCATGGCCTCTTCTCCTTCCTGACGGGCCGATAGGGTCCCGCAGATGTGGGCGATGGCGTTCGCCACGGCTTTTCGCGTGCATTCGAATTTGAA
AGTTTCGCCGATGACGTCACTAAACTCCTCCATCCATTTGAACGCCAGCGGGTTCGCGTTGGCGCGAAGGGATGGTAAAAGCACCGAGACCAGATGCGCG
TTCTCTTGGATGAGTTTATCACTCCACTTGTTGCCATCGTTCCGGCTCCNNNNNNNNNNAAAACTCCTCCATCCATTTGACCGCCAGCGGGTTCGCGTTA
GCGCGAAGGGATGGTAAAAGCANNNNNNNNNNAACATAGGTAGGCTGTCGAGGGATCCAACAGCTTGCGCGATCGCCTGCAGAGCCGTCTGGGCGCCTTG
GATCCGGACTTGAAGCAACTGCAGCGCGTCGTCGTTGTCACCTGTCAAGTCTTCGTCATCAGTCTCGCGATACGCCAATGCCACGGCACTGTTGCAGAGA
TTGGAGACGATCTTGTTCACGCACTTGCGCTGTACATCCACCTGGGAGACCACAAAATGCGCCAGCGTCTCAGCTGTAAATGCCCGAAATGCTGGTGTTT
CTTCCGTTTTGATCGACGCCATTAACGCACTCACGAGGAAGCCGCTCTTTTTGGTCGGGATTTCAAGTAGTTCACCGAACACGCAACTTCCCAGACCTTG
GACACGCGCATACATACGCGACGACGCACGCTGGATAACGTCGTCAAGTAGGAAGAGATCTTGGCGACCAAAATGGGCTTGCTCAAAAGCCTGCGGGTCC
TTCGTGAGCTCAGTGAACGGGTACTGAGCGACGCGCTCGGCCACTTGGCGAGATATTGTCGCGCACGATCCTGTAGAGCTGGGTGGATCAATTGGTTTGA
CGCTGATGCTGGAGGTCTCGAACAGCTCGATGAGTCGTCGCTCCATTCGAAGGACTCGTTGAAGGGATGCCGCTTGCTCGGAATAGTAATACCTATCGGA
CGACGTTGCCACTGAAACCCAATTGCGTTGAGCTAGTGCCTCCACTATCTCTCCCATGTGGTCGCGAAGTACAGCAAGGAGGTTGAGATCATACCCTTTT
CGGTTCCTGGTATGAACGGCCCACCAGTAAAGCAGCAACAGCGATCCACACTGCTGCTCACCGGATAACGAGTTGATGCCTTGAGTAATTTGCTTGATTG
CCGCTTGGTACGCTTCTGACTTTGGTGGAACATGACTCATGAGTAGACCCAACGCCTCTGCGAATGACACCCGAGCAGCGATATTGTCTTTGGACGGCAG
TAAGACCGACGAAAAATCCGCTGCGTCATCTTCGTCGTTCGCCCTCGCAAAGTTGAGCACGCTGACACTGTCCAGCGTCCATACTATTTCGATCCATTGT
GGAAGCAGCCTGTCAATGAGCTCAACGAGGCTGTGAGTACCTGAACACCACTCGACGACCGCCGCCCAGGTCAACAGCACAACGCTGCGAGCGTCTTCAA
TTTCGTCCCGCAAGAGTTGAAGCAGTAGGCGTGACAGTAAGTGTTGGACGGTGTCTGGAGACACGTTCTCAAATAGTCGCCCATCGCCTTGACTGACGAG
TGCGCGGATACACGTGGCGGTGGACACACGAACCGCTTTGTCGTGGTGGTGGAGAAGCGGAACAATTCGCGCAATGCGTTCCCACAGAAGACTCGCATTG
GGGTGACTTCGCAACATCTCGGCGACTGGAGCATGCTCGTACCATAGTCGCAACGTTTGGATCGTCGCACTGGCCACAAAGCTTCGTTCACCCGTTGCGA
TCGCCCACAGCGATTGAGAGGCTCGGTGGATTGTCGAGTTGGATACTGGCGGACTGAGATGCTGCACGATATCGCCGAGGATAGCACTCGCGACGATGAG
CACATCTTCTTCGGCACCTCGCCTCTTGACCTCCAAGATATCGACGACATCTTCCACAACCAGCGGTACAAGAGCCGCGGCGTGAGCAGCATGGGCCAGC
AGAAGGTACTTGATCCCGAGCAGGCCGCCATGGGAGGCGTGCCACGATGACGGCGACCCAAGCAGCTTGCGCAGCACACTAAGATACTCCTGGAGAAGCT
GCTGGTCGTGGAGACTACCCAGCAAGATGCCAAACACTTGAGCCGTCAGCTCGCGCACGGGTGCGACGGAGCCGTCGGCCGAGTAGTCGACAAACTGATC
GAGTGCGAGCACGCACAGACACCGTACCAAGCTCTCTTCGATCCACTGGTCCACGAGACCAGCATCCGTCGTTCCAGCGACCCCCTTCTCCAGCCAGCCG
CTCGAAAGGAGAATGTGGCGCAACGCTGCAAAGCCGCCATGGCGCACTTCCCA