Description :
From Genome Similarity Track
Location :
contig_5:152801- 160083
Transcript NameFunction/comments
g1517.t1hypothetical protein
g1518.t1OWZ22882.1 hypothetical protein PHMEG_0002336 [Phytophthora megakarya

Sequence
7282 bases(100 bases per row)
CTACTCTTTTCTTCTCCCCTTTGCTGTTCAGACGACGCGTCTTCGTTGGTGGACGCACTTCATCCACACTGCACTTTGGTGCATGAACCAGAGGTATAGC
TTCGTCCACGCGGCGCCTTTTCCTCTGTATTTCCTCCGGGGAAATAGTCTTGGACGTGGCGACGCTCACCACTCGAGGGGGTGACTGTTTCTCAGCTGAT
TTGACGCTCGAGTTCCCCCCCTGCTCCTTCGTTGCCATAGTTTCCTCCATCTTCCTCCGGGTAACTACCAGGGTTTGCTGCAGCTTCCAGAACCTGGTGC
CCTCTTGTTGGTCACGTGGAGGGCTCTGAGAATCTTGAACCAATCGAAGTACACCCGCCGTCAACCCGTTGCAGGTCGAGACGTTCTGGAAGCAGTAGAG
CTCCCTCACACCCACGTCTGGAGCAAGTTTCAACCCAACTCGAAGCAGTCGCTCCCATTTTTCCTCCGTCATCACCTGCAACTCCTCCACGAACCCCGCC
GCTGTAGCGGGCCACACAGCCACACACTTCCCATCAGCACTCGCCAGTGCAGTCTCCGCCTCCTCAAAAGCTCGCTCCAGTGTCTTTATTCCTTCCATTC
CGAAATTGGCATCGACAATTGGACTTCAACTGACTGACCATCATTCTTGTGTTTAGTGTTCTACACCTCAAATAGGTCTTACGCGGGAATAACCGTGCTC
GCCATTTTTCAACGGCAGTGCGCGCGGAACTGAGCGCTTCATTGACAGGTGCTGGCGCACGAATGGAGTCTCCGCGGCGCCCGTCGGCGGCGTCTGGTCT
GTACCAACGTCCTGTCTCTCTGATTCGTCATTTTCGCGGCCCGACAGCCCCCTCCAACGCCCGAACGACAGCTTCGCCGAGTCTCAGCAGTGCAGCGCTG
ACCCGAGCGCCTTTCTGGGATTCCACGTGCCTCCGAGCGCCGAGGAGGTGGAAGTGGAGCCTGCTCATCTTCAGCAGAAGCAGAAACAGACCCCGAAACT
GGTGCTGAACCTGGATGCGAGCACGAGAGGCGACAACGGCTTCCGACCTGCGACGTCGTACGAAAGTTCGATACGCACGTCCAACCCGTTCAGTGAATTG
TTTGAAGGCGACACGCAGGATGATGAGAACGTGGTGATAGACCAAGTTGCTGCAGAGAGACGAGGTGAACTGGTTCAGAAGAACATGAAGGAGGTTTTGC
CGTTGAAGAGACGGCGACAACGTGAGGATGACGCAGGTGCAGACAGGTCAAGTCCCCCGCCTACGATGCTGGCGTCGATGGAAAGTGCGTGGCGAGCTCG
CAAACGGAGAGTGGCTGAGAGTTCACTGGACCTGAAAGGGTCGACTGGAGAAGTGGATGCAGCACAGAATCAGAACGGCCAGAAGGATGTCCAGGAAAGT
TTGGACGCAGAGACGATGGATGAAGCACGCAAATTTGCTGCTGCTACTGATGCAACAGTGAGTCAAGAGAGTGCTGGGGGGAAACGCGCTGATGACTCGC
TGCCAGGAGCTAGCGCGTGTTCGGAGTATAGTGAAGACCTTGCTCCGCGGATTTTCCAGGCTATGGTTAAAGTTCCCACCAATGAGTCGATTATTCATGA
GAATTGTGGCAAGAATTCGACAGACCATGTTCAATTTGATACCAGTGCGATGTCAGAAGACAGCGACCGGGAGACCGATTACGAGGATGAACTGGAGTGT
ACACAGCAGCTTGACGATGATGGGGCTATTGACGATATGGACATGACTCGCAGCTATGAAATTGGAAGCGATTGCGATGAAGAGGATACAGAAGTATACC
CTTATTCTGATACAGGCACTTTACCATACGGGGCCGACTCGACCATTCTAGATGATGGCAACGATGACGAGGCAAATCCACAGAAAGAGACTGCGGGCAG
TGCTTCGAGAGAAGAAAAAATGACCCTTGTGCCGACGCCGGATCAAATCAGTGACCAGCGAAGAGCTGAGGACGAAGCAACGAGTCGAGAAGGGTCACAA
ACTACCCAACAGGACTATCTGACTCCAAGAGTTGTCCCCAGCCGATCTAAACGATCCGATGCTGCCGAAACCAGCACAAATTTTGTCGTCGCAGTCGCCC
CTAGTGGTGATGATGAGCAGAGCTCGCAGAAGTCCCAACATGACAATGATCCAGATGAGTGCGTGCCTACTCAACCTAGTAAACCTCGGGCGGAGAGTGA
ACCCATCGTCGAGCCGAACTTGCCTTCGCAACAAAACGTATCCAAGAAGAGCGATGTGCTTTTGACGAACGAGCATCTTGCTGGAACCGATTCTCAGGCA
AAAGCGATCCGCACACTAGAGTTTTCGTTCTCGATGCCTGAGTCGCAGGAAGGCGAGCCACACTTCAGTGCAAGCCTGCCAAGTGAAGGGGCAGCTGTGT
CAAAGAGATCAGAAACGTTCTCTCGCAGTGACAAAACAAGCCCTTTCGCGTCTTCTATCAGCCCGGTATGGGCGGCAATTCCAACCCCCATACCTGTAGA
GGGTTCTGCCGTTCCCGATGTCACTGGGGTCACGATAAGTTTGAAGAAGAAAACCACATCGCCATGTGATTTGCCGACAGGAAAGAAGCAAAAACATTCT
GCTGAAGGTACCGATTCCCCTAGCTCATCCAAGCCTAAGAGGAGTAAGCGCGGTTTTTTTACACCTGACAGTAGCAGCACGCCAAAAGAATCGGACGGAG
GTGATCGCAAACTCCTCGGCCTCCTGCCCGCCGCGGCACTCGGTCCTCTCAGTCCACACCTTCATCAACCCTACAGTTCGAACACGAACAAGAACACTAA
CCCCCGTGCCGTCACAGCGTGCATATGCTTCAAGATCTCGAACGCTATTCAAGTACAAGTTCGAGTTTTGCTTGACGGGCTTCGTGAAGACCGGTGAAGA
AAACTTGAAGGAGCTGATTGAAGGTCACGGAGGCAAAATTCCTGAAAGATACCAGGATGTTCTATACAAAAACAACGTCAAAGCTGTGGTTATCGCAACA
CCGGTATCATGGCGCAAGCGCAAGTTTATGCAAGCTGTGGCATGTGGAATCCCCGTCGTTCATACAGATTGGATTCACGATTGTATTGAAGATGGCTATG
TGGTACCTTTCGATGGCTATCAAGTCCCAACAGGCTACTCCGTTACCACTCGAAAATTCGAGTGTTTCCCCCCTAGAGAGGTAAGTCCTCTCGAATAGGT
CGAACGCCTGGGATGGTTGAATGCAAAACTAACCTTTTTGCTGCGTGCGGTTGTGCGAACAGCTACACATTTTTGAAGGCTATTCCTTTGGTATTGTCAG
TGACGTGGCACAAACGTCGAAGGCAGAAGCGAAGGACAAGGCCAATCTGATGGCTTTTATTTTGAAGGCTTGTGGTGCAGATGCTGTATACGAGGTTAGT
CCATCGGTATCAGTAACACTCTGTACGGTCGATGTTTTGTCGTCCACTAACGCGTGTCGTGACTTGTAGAATCTGTCTACCAAGAGCGACGTTAACGTGG
ATGTGGTGCTCTGCGACGAGTATACTCAGGTATGGAGCATTGATACCAACCATGCTGTATGATCTAGCCGTTTGACCGGTAATTGTGTATCCTTGTGTCG
TCTAAAATATAGACTTGCCGGTACTACAAGAAGAAACGCCGCGTGCCGGTGAAAGACTTCCAGTGGGTTACCGAGTGCATGATCCTTCAGGTACACATAG
CATGAGATAATCCGTGTGGTAGGAAATATCGTCGATCTGCCAACTAACACAGAGTTTGGCTGTTTCTTAGCGATGTCTGGATCCCGAAGAACCAGTTTTT
GAACCACAGCGCGTAGGCTGCGTAGATGTTTTTGCAGCAAGCGCTGAAATTGGTGACAGCGACAAGTACGTTCTGGGCCTTGTTCTCCACGTACCTGTGA
ATGGCTCGCTCATATATTCCTGTTGCGTCTTGGTAGCACGACCCTGAAGTTATACACGGGGGAGCTTGTGATGGCGGACATCTCGGGCAGTGCAGCCGAC
CACTACCTCCTGTTCAATGTCTGCGAAATCCTCAGTATTCACGTAAATGCACGGAAAGATGAAGGCTCGCAGTCAAAGAGGAAAGACAAAGGAAGCCGCG
TTATGCTTCGTGTGGGCATGTTGAAACGGTACGCTTTGCTTTGTGTAGTTGCTTGTTGCTGGGCTAGTTGTGTTGACAATGTTGCACTGTGTGTGGAATG
AATAGCGAGCCTTACAACCCCGAGCTGTCAAAATCCCCCGCCAATGTGCTGGAAATCTCATCATCACAAGTGAAACGAAGAGTGGTGGCGATTTCTAGTG
GTGGCGATTTCTAAGGAGGACTATGGCAAGCTGAAGTATAAGGATGAGAGTATCTTTTATTTGGAGGAGGAGAGCGATCTGAACAAACTCGCCGTGTCTG
AGCACAGATGGCTGACACAGTGACTGCATCGTTGCTCTGTTGTTAATGCTATCACAAAACGCCTCCGCTTCAGGAAAATCTTTCTTGTGCGTTTCACTCG
TGTTGCTCTTCAGGGCCACCCTGATCTCGCGCATTTCGTTCATCAAGAATCATCCTATTGGGGATGAATAGATGGAGCCACGGCTAACAACGCGAAGGAA
GCCAATTTAGTAGGATTGAGAGTGAGGCTGTGCTGGTGCTGTCAACTGGCACGTACTTTTCGCATAGGGTCGACACCAGTGTCTGAGAAGATGGTCTGTT
TGGAGAAACAATCACACGCAGCATTGAATTCGTAGGCTTTCCTCTGCTACCATTCGTGCAGCGTACCTGCCACGAAATAATGCCCAAGTGAGTAAGCATC
ATGCGGTAGTAGTTGGTGAAACTCTCGGCCAGAAAACTCCATTTACCACGCAGGTCCCTAAACCAAATCTGTGGTGCTTCTGCTTGCAGTAATAATGACT
TAGCCACAGTCCGCAATATATAAGGAACAGGGAGTGCAGTACCATCGAGGTAGACGAGCGCGACAGTGCCGTATTTTGTCGATGTCTCGAGAAAAAATCC
TGTGAGTTCCTTGTGGTTGACCTAGAGCCAAAACCGTGTGAACTCAAACACGTCGCCAGAATACAATCCAAATCACACTCACCTTTCTCAAGTCGAGTCG
ATGCTGATCTACGGGCCGGCATTGTGAGGGGAGATCCTTGATCGAGAACCGTTGCAATTCCTTAACAGGCTTCAGCAAGAAATGACCAACCAAGGTGGAG
TGGTCTGAATGATGCAATCAAAACAAAACAAAACAAGCTGGTGTTCACAACGCTGCACTGCAACTACCCTTCTGCGAGATATCCTACCGCGAAATGGAGC
AAACCATTTTACCGACAACCCGTTTGCGATCGAATAGAACCGCTTCAAGTCGTCTGGAAGTAGATACGGGGAGTTTTTCTGGAGCAACGCATCAACGTCA
GCATGAATATCTTTTTCTGTTCTGGCCTCCCTTCAAGGTGCACACCTGCTCCCAGAGTCCAAGTTCCACCTGGGTAGCCCCAACAAACGGCTTCGACTCG
ACGCGCGACACGCGCTCATGAGCTTGCAAGTACGAAAACACTCCGAGGGAAATGGCGTCCAAATGCTGCATTGGTGCTGCCGAAGAATGAACGAGCGCTC
AGATTCTAAGATAAGAGCTGCACGGGAACAGGCGGAGCCGGCGTTGCAATCCTCTAGCAATATTACGACGGAATAGCAGCTATTACAACGATCCCTGAAA
GTGCGACGAGGCTCGACTACATGATTGAGCACTGCTCTTGGCCTGGGCCGCCACCAACTAACCACAAAATCAGCAAGAAGCAATCAAGAATTAGACTCTC
TCCTGGACAAAGTATCAAAAGTTGGACTTACGTGGCATGCCAGGCATTCCAGCCATACCGGGGAACATGCCAGCGCCCTGCAGAACCCGGACATAACACA
GTTAGACCCTGTACGTAGTTTCTGCTCCAACGTTGTAAAGTAGAACGAACCATATTCGGCATAATCGGCATCCCTTCGTCATCAAACTGCAAGCCTGTGC
ACCGAGTTGAATAAAGTAGAAGTAAGACGCTTCTTTTCAAAAACAACAACATTGACTGAGGCGTACCTGGGGCAAGGTCCTTCACGATCTCCGAAGGCGG
TTGGCCGGTCTCCTGCATCTCCTGCATAAGCTCTGACAGTCGAGCGTAATTATCCGGCTCTGACTCGTACGCTGCGACGATCTGCTGGAAGTACTGGTAC
TGCTTGCCATATCTGCGCAAAAAAATAAACAGCTCACATTCAGGAAGGCAGTCGACAGAAAGCACACACGGATACACAAATGCCTACCGCTCGTAGTCTT
CTTTAGACAACAGCGACTCTTCTCAGCTAGCCACTCAGGATACTACGCAAAAACGCAAAAAAAAACAACAACTCGTGATTAGCCTCCATCAAGCAGCAAA
GTCATACCCCTTTCAGTACTTGCGTACCCGCTCGCAGATCTGCTTCATGGGATCATACATAACGTCCTTTGATAGCAGTTGCTGCATCATGCCGTCCACC
AAGTCCTGGAAATCGCTCTGCCCCCAAAAATCACCGTCAATAACCAGACACAGGAAGTCACTCAACTCCTGTAGCCACCGCACCTTTTCGCCCATCTCTT
CAAACTTCTTCATCATCTCCGACATCATATCCTCGCCCATAGCTTCCACCTGGGCCGTACCGACGCCCTCCATGTCTTCCGCCGCCTTGGCCATATTCTG
CAGCGTTTTGGCCACGCCAGCGTTCACATCGTCCGTCTCATCGGGCGTCGCGTCCACCTTCAACGAGCCCAGCAGCTGCTCGATGTTCTCGGCGTCGTCT
GCATTCACCACAAGAGCATCAGAACCTCTCCATCAATCTCTTCACTTGACTCCACTATACCGTCCGTGCCCAGCTCTCGAAATGCCTGCTCCAGCACCTG
CTGGAACTCGGGATTCTGCGCGTCCTCGAGGAACTTAGCCATGTTCTGCCCCCATAACCACAGCGTCAGCGCTTCACTTCGCCTCGATCAAGTTCTTAAC
AGTTTTGATAACCTCTTGCAGTTTGTTGTCTTCGCTGTCCCGCGTCGCAGCAGCGGTGGCGGCCGCTTCCTGCTGCACGGTGGCCATCTCCGAGGCTTGG
GCGGTGCTCACCTCGTCCGCAAAGTCGTCCAGCGCATCTGCAGAGACGGACAGTGAGCGGGTGTGTGTGTAGGTGAAGGAGGCATGGGTGGTTACCTTCG
AGGAGATCGTCCAGATCCACTTCCTCCTGCGTCTTGGGCTCGCTCTCCTCCTTCGTGCTCATCGTCAGGCTCTGGTTGACGT