Description :
From Genome Similarity Track
Location :
Scaffold_667:1528- 2975
Sequence
1447 bases(100 bases per row)
GCCACAACCTCCTTCTCACGAGGATAATAGTTCATCTCGAATTCCTTGAGCACACGGCTGAGGGAATCGAACGGGGTGTAGCTTGCCTTTCGTGTTCTTG
CATGAGCGTAGTGCTCAACACCCATTCATTCGCGAAGAGCATGACGTGAGCTGGTCTTCGACCGATCGAAGTGCCTGAGGATGGGTAAATGTGAAACACT
CGCCTTTAATTTCTCGAAGGAACGACATGCCACAGAAAGACCGCTTTCAGCGATAAAGTCTTCATCTTAAAGCTGGTACAGCGCCGCACCGTAGACCGCG
AAGTCTTGAATGAAGCGGCTGTAGTAATTAACCGCTCCAAGAAACGACTGCATGCCCTTCTTGCTCGTTGGAAACGAAAGCTCGGTGATGGCCGCAAGCT
TCTTGGGGTCAGCTCTGATACCTTCTGGCGAAATTTTATGCGACAGAAAGTCCACCTTGGGTTGGCAAAAGATGCTCTTGGTGAAGCTAATGCTGATCCG
ACACTGTGCAAATCTTGCTAGCAATCGGTCCAGCGTCGCCAGGTAGCTGTCGAAATCCTCGCCACCGAAGCAAATATCATCCACAAACGATCGTCGACCA
AACACAGGTACCAGCGATGATTCGTCTGGTTCCCCGTTCGTAAACATAACAGCGACGGGATGTTGACGAGCTGTAGTACAGGGTCGGTCTCTACCGGTGC
TTCGCGGTCTGCCGCGAACTCCGTTTGAAACGAACCCTCGGCGCTTGGCCCACGACATTCCTTGGCCTGTTCTTCAGCTAAACGCATCCTCTCCGAGTAT
TCAAACCAACCTCCTTTAGGTTTAACGAACCCCCAGAGTGCGTTGTCAATCATACGCTGGTAGATCATCGGCGCGTTCGTTAACCCGAAGGGCATGCGTA
ACCACTCGAAATGTCCGAGTGCGCAGACGAACGCCGACACTTTACGCGCTCGCATGGTCATCATGACCGCCCAGAAGCCGCTTGATGCATCCAGCGAGCA
GAACCACAGGTAGCGATCGAGGTCTGTTAACAGGTCGTCGACTAGCGGCATTGCATACTCCATGATCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN