Description :
From Genome Similarity Track
Location :
Scaffold_61:152761- 155031
Sequence
2270 bases(100 bases per row)
AAGGTACTCTTCACCAGAATAGATCTGTGTCCAGATTCGAAGATACGTGTCATGAAGCAGTGGCCACTAACTCGTGAGCTAGTACTAGTGATCAACATAT
TACTTACCGACCGTTTAGTAGCGGGCCAAGTGAGGAAATCAATTTCCTTATATAGCTCTCCAGCCTTCTGCGTACAAAATTTCACAGAAGGATGGCAGAT
AGTGCATGCGATCGCACGTCAAATATCGCATGGTATCGGTCCAGACATCGATACCCAGAAAAGAAGTCATCATACATGGTGTGGCAAGGAGTGCCATCTT
TTCGTCCATGGATCTGATGAACTGGTTCTATCCGATCCGAATGCGTGAAAGGGACATCCCGTATCCCGCAGTGGGCACCCCGAGTGGTATGATCTATGAA
TGGCTAGTGATTTCACAAGGATTAAGCAATGCCCCTGATACACTCAACATATGTGTGACAAATATTTGAGATCTGTGCGCGCACCTTGTTATTTTGACTA
TGTGTTCGTCCATAGCCGGGCTGTGTAAAGACAGAGAATGTAGGAATCCATAAACTCCACGTCTGGAATGTTCTTACAATTATGCGCGTGAATATGTCGT
GAGCAACCTTAAAAAGTAAAGATTTTCTGCTAGCAAAATGCTACTTCTATGTGTATTGATGGTAAAAATGGTGTACGGCCCGACCCGAAAAAGATCGGGG
CGGTCACCGAATGACCGGTGTTTGTCGACGTAAAGGGGCAGAGGAAGTTTTACTCGGACTAGGGGCGTACTTGCACAAGGACTCGCGCAACTACGCGAAG
ATGGCTTTTCATCTTTCTCGTTTATTATAAAAACGTAAAAAGCGGGTATGGATTGCTAACTGCCAGATCTCGTTTGATGGTATCAAGAAGAGATTGATAA
GGTCACCATTGGCAATTTCAGACCAAGACAGGCCATTCCACGTGGTCTATGATGCCAGCGATCATGCAATAGGCTGTGCATAGATGCAGTACGATACAGA
CGGTGCGGAGAGTGTCGTCTGCTATCAATCTCGTCAGCTAAACCTGCTGAACGTAACTATACAGTGTACGACAACGACCTCCTTGCCATGAAATACGCAT
TGACCAAGTTCAGGGTATATTTGTGAGGATAGATACCCTTCGTAGCCTATACAGACCATGCATCATTACGTACTACCAACCCACACCACTTGCATCGAAC
GGCGTGGTGGCTATATTTTTTGTGGAGAATAACTCCTCCGTGGAGTTTAAACCAAGACAACTCAACATCGTCGCTGACGCACTCTCGAGCCGGCTCAATT
TTGACCCGGATGCGCAACCCAAAAGTGCGGCAACCTCTGTTGTGGCGTTGACTTCAAGCGTCCACTTTAAATATTTTTGGAATACATACGCAAAGTGTAT
ATGTGTAATCCATAGTTCGTGAATCTAATGGGCCATCTCTCACAACCTTCCCGGAAGAATTTAAAAAAAATCAAGGCGGTGTATCGGTCCTTGACGGACC
GATACACCGTGTGTACTAGACTAATGTATTATTACGATGTTACCGGCTACATGCGTCGTGTCGTCATGTTCAATTATGGTGATCTGCGGTTGTGGATCAT
GTTTGAGTGCCAGGACGCACCTTTTGGTGGGCATGGTGGTCGTAGGAAAACATATATCACGTTCAGTCTGGACTTCTATTTGTCCTGGCCAGTATATTTC
GCTAGTAAGTAAGTTCGCGCTTGCGAAGTCTGTTGACGAATGAAGATTGGTCCTTCACGTCTGTAACCCTTTAACCCTCTGTCTGTCATGACAGAATTCT
TGGAGTTTGTTTAAACGGACTAGGTCTTTGGGTTCCCCAAGAAAACATAAGAATAATGTTATTCTTGTGTTCGTAGATCGATTCAGCAAAATGTCGAACC
TCGTTGCTGTACCTATATCGATGACAGCCTCGGGTTATGCCCGTATCTTCATCAACGCAATCGTTCGCCTTGATGAGCTGCCCTTGAATGGTTTCCCATC
GGGACTCACTTTTCCTGGCTGATTTCTGGCGCTCCGTGTTCAAACGCTCATAACACGCCCCAAGATGTCTACATCTGATTAACCTGATAGAGATGATCAT
ACGAAACGCGCCAACTTTGACCTCGCAGAGATCTTTCGAGGATATGTCCATTCTTTTACACTTTGAAACGAATTTCTGCTGATAGTGAAATTCGCCATCA
GCAACTCAGTACATGCGTTGACGGCGCATACGCTATTCTCTGTGAATGGCTTGTGCCATCCGCGTCTACC