Description :
From Genome Similarity Track
Location :
contig_5:152756- 160038
Transcript NameFunction/comments
g1639.t1hypothetical protein
g1640.t1ETP32186.1 hypothetical protein F442_19056 [Phytophthora parasitica P10297

Sequence
7282 bases(100 bases per row)
CTACTCTTTTCTTCTCCCCTTTGCTGTTCAGACGACGCGTCTTCGTTGGTGGACGCACTTCATCCACACTGCACTTTGGTGCATGAACCAGAGGTATAGC
TTCGTCCACGCGGCTCCTTTTCCTCCGCATTTCCTCCGGGGAAATAGTCTTGGACGTGGCGACGCTCACCACTCGAGGGGGTGACTGTTTCTCAGCTGAT
TTGACGCTCGAGTTCCCCCCCTGCTCCTTCGTTGCCATAGTTTCCTCCATCTTCCTCCGGGTAACTACCAGGGTTTGCTGCAGCTTCCAGAACCTGGTGC
CCTCTTGTTGATCACGTGGAGGGCTCTGAGAATCTTGAACCAATCGAAGTACACCCGCCGTCAACCCGTTGCAGGTCGAGACGTTCTGGAAGCAGTAGAG
CTCCCTCACACCCACGTCTGGAGCAAGTTTCAACCCAACTCGAAGCAGTCGCTCCCATTTTTCCTCCGTCATCACCTGCAACTCCTCCACGAACCCCGCC
GCTGTAGCGGGCCACACAGCCACACACTTCCCATCAGCACTCGCCAGTGCAGTCTCCGCCTCCTCAAAAGCTCGCTCCAGTGTCTTTATTCCTTCCATTC
CGAAATTGGCATCGACAATTGGACTTCAACTGACTGACCATCATTCTTGTGTTTAGTGTTCTACACCTCAAATAGGTCTTACGCGGGAATAACCGTGCTC
GCCATTTTTCAACGGCAGTGCGCGCGGAACTGAGCGCTTCATTGACAGGTGCTGGCGCGCGAATGGAGTCTCCGCGGCGCCCGTCGGCGGCGTCTGGTCT
GTACCAACGTCCTGTCTCTCTGACTCGTCATTTTCGCGGCCCGACAGCCCCCTCCAACGCCCGAACGACAGCTTCGCCGAGTCTCAGCAGTGCAGCGCTG
ACCCGAGCGCCTTTCTGGGATTCCACGTGCCTCCGAGCGCCGAGGAGGTGGAAGTGGAGCCTGCTCATCTTCAGCAGAAGCAGAAACAGACCCCGAAACT
GGTGCTGAACCTGGATGCGACCACGAGAGGCGACAACGGCTTCCGACCTGCGACGTCGTACGAAAGTTCGATACGCACGTCCAACCCGTTCAGTGAATTG
TTTGAAGGCGACACGCAGGATGATGAGAACGTGGTGATAGACCAAGTTGCTGGAGAGAGACGAGGTGAACTGGTTCAGAAGAACATGAAGGAGGTTTTGC
CGTTGAAGAGACGGCGACAACGTGAGGATGACGCAGGTGCAGACAGGTCAAGTCCCCCGCCTACGATGCTGGCGTCGATGGAAAGTGCGTGGCGAGCTCG
CAAACGGAGAGTGGCTGAGAGTTCACTGGACCTGAAAGGGTCGACTGGAGAAGTGGATGCAGCACAGAATCAGAACGGCCAGAAGGATGTCCAGGAAAGT
TTGGACGCAGAGACGATGGATGAAGCACGCAAATTTGCTGCTGCTACTGATGCAACAGTGAGTCAAGAGAGTGCTGGGGGGAAACGCGCTGATGACTCGC
TGCCAGGAGCTAGCGCGTGTTCGGAGTATAGTGAAGACCTTGCTCCGCGGATTTTCCAGGCTATGGTTAAAGTTCCCACCAATGAGTCGATTATTCATGA
GAATTGTGGCAAGAATTCGACAGACCATGTTCAATTTGATACCAGTGCGATGTCAGAAGACAGCGACCGGGAGACCGATTACGAGGATGAACTGGAGTGT
ACACAGCAGCTTGACGATGATGGGGCTATTGACGATATGGACATGACTCGCAGCTATGAAATTGGAAGCGATTGCGATGAAGAGGATACAGAAGTATACC
CTTATTCTGATACAGGCACTTTACCATACGGGGCCGACTCGACCATTCTAGATGATGGCAACGATGACGAGGCAAATCCACAGAAAGAGACTGCGGGCAG
TGCTTCGAGAGAAGAAAAAATGACCCTTGTGCCGACGCCGGATCAAATCAGTGACCAGCGAAGAGCTGAGGACGAAGCAACGAGTCGAGAAGGGTCACAA
ACTACCCAACAGGACTATCTGACTCCAAGAGTTGTCCCCAGCCGATCTAAACGATCCGATGCTGCCGAAACCAGCACAAATTTTGTCGTCGCAGTCGCCC
CTAGTGGTGATGATGAGCAGAGCTCGCAGAAGTCCCAACATGACAATGATCCAGATGAGTGCGTGCCTACTCAACCTAGTAAACCTCGGGCGGAGAGTGA
ACCCATCGTCGAGCCGAACTTGCCTTCGCAACAAAACGTATCCAAGAAGAGCGATGTGCTTTTGACGAACGAGCATCTTGCTGGAACCGATTCTCAGGCA
AAAGCGATCCGCACACTAGAGTTTTCGTTCTCGATGCCTGAGTCGCAGGAAGGCGAGCCACACTTCAGTGCAAGCCTGCCAAGTGAAGGGGCAGCTGTGT
CAAAGAGATCAGAAACGTTCTCTCGCAGTGACAAAACAAGCCCTTTCGCGTCTTCTATCAGCCCGGTATGGGCGGCAATTCCAACCCCCATACCTGTAGA
GGGTTCTGCCGTTCCCGATGTCACTGGGGTCACGATAAGTTTGAAGAAGAAAACCACATCGCCATGTGATTTGCCGACAGGAAAGAAGCAAAAACATTCT
GCTGAAGGTACCGATTCCCCTAGCTCATCCAAGCCTAAGAGGAGTAAGCGCGGTTTTTTTACACCTGACAGTAGCAGCACGCCAAAAGAATCGGACGGAG
GTGATCGCAAACTCCTCGGCCTCCTGCCCGCCGCGGCACTCGGTCCTCTCAGTCCACACCTTCATCAACCCTACAGTTCGAACACGAACAAGAACACTAA
CCCCCGTGCCGTCACAGCGTGCATATGCTTCAAGATCTCGAACGCTATTCAAGTACAAGTTCGAGTTTTGCTTGACGGGCTTCGTGAAGACCGGTGAAGA
AAACTTGAAGGAGCTGATTGAAGGTCACGGAGGCAAAATTCCTGAAAGATACCAGGATGTTCTATACAAAAACAACGTCAAAGCTGTGGTTATCGCAACA
CCGGTATCATGGCGCAAGCGCAAGTTTATGCAAGCTGTGGCATGTGGAATCCCCGTCGTTCATACAGATTGGATTCACGATTGTATTGAAGATGGCTATG
TGGTACCTTTCGATGGCTATCAAGTCCCAACAGGCTACTCCGTTACCACTCGAAAATTCGAGTGTTTCCCCCCTAGAGAGGTAAGTCCTCTCGAATAGGT
CGAACGCCTGGGATGGTTGAATGCAAAACTAACCTTTTTGCTGCGTGCGGTTGTGCGAACAGCTACACATTTTTGAAGGCTATTCCTTTGGTATTGTCAG
TGACGTGGCACAAACGTCGAAGGCAGAAGCGAAGGACAAGGCCAATCTGATGGCTTTTATTTTGAAGGCTTGTGGTGCAGATGCTGTATACGAGGTTAGT
CCATCGGTATCAGTAACACTCTGTACGGTCGATGTTTTGTCGTCCACTAACGCGTGTCGTGACTTGTAGAATCTGTCTACCAAGAGCGACGTTAACGTGG
ATGTGGTGCTCTGCGACGAGTATACTCAGGTATGGAGCATTGATACCAACCATGCTGTATGATCTAGCCGTTTGACCGGTAATTGTGTATCCTTGTGTCG
TCTAAAATATAGACTTGCCGGTACTACAAGAAGAAACGCCGCGTGCCGGTGAAAGACTTCCAGTGGGTTACCGAGTGCATGATCCTTCAGGTACACATAG
CATGAGATAATCCGTGTGGTAGGAAATATCGTCGATCTGCCAACTAACACAGAGTTTGGCTGTTTCTTAGCGATGTCTGGATCCCGAAGAACCAGTTTTT
GAACCACAGCGCGTAGGCTGCGTAGATGTTTTTGCAGCAAGCGCTGAAATTGGTGACAGCGACAAGTACGTTCTGGGCCTTGTTCTCCACGTACCTGTGA
ATGGCTCGCTCATATATTCCTGTTGCGTCTTGGTAGCACGACCCTGAAGTTATACACGGGGGAGCTTGTGATGGCGGACATCTCGGGCAGTGCAGCCGAC
CACTACCTCCTGTTCAATGTCTGCGAAATCCTCAGTATTCACGTAAATGCACGGAAAGATGAAGGCTCGCAGTCAAAGAGGAAAGACAAAGGAAGCCGCG
TTATGCTTCGTGTGGGCATGTTGAAACGGTACGCTTTGCTTTGTGTAGTTGCTTGTTGCTGGGCTAGTTGTGTTGACAATGTTGCACTGTGTGTGGAATG
AATAGCGAGCCTTACAACCCCGAGCTGTCAAAATCCCCCGCCAATGTGCTGGAAATCTCATCATCACAAGTGAAACGAAGAGTGGTGGCGATTTCTAGTG
GTGGCGATTTCTAAGGAGGACTATGGCAAGCTGAAGTATAAGGATGAGAGTATCTTTTATTTGGAGGAGGAGAGCGATCTGAACAAACTCGCCGTGTCTG
AGCACAGATGGCTGACACAGTGACTGCATCGTTGCTCTGTTGTTAATGCTATCACAAAACGCCTCCGCTTCAGGAAAATCTTTCTTGTGCGTTTCACTCG
TGTTGCTCTTCAGGGCCACCCTGATCTCGCGCATTTCGTTCATCAAGAATCATCCTATTGGGGATGAATAGATGGAGCCACGGCTAACAACGCGAAGGAA
GCCAATTTAGTAGGATTGAGAGTGAGGCTGTGCTGGTGCTGTCAACTGGCACGTACTTTTCGCATAGGGTCGACACCAGTGTCTGAGAAGATGGTCTGTT
TGGAGAAACAATCACACGCAGCATTGAATTCGTAGGCTTTCCTCTGCTACCATTCGTGCAGCGTACCTGCCACGAAATAATGCCCAAGTGAGTAAGCATC
ATGCGGTAGTAGTTGGTGAAACTCTCGGCCAGAAAACTCCATTTACCACGCAGGTCCCTAAACCAAATCTGTGGTGCTTCTGCTTGCAGTAATAATGACT
TAGCCACAGTCCGCAATATATAAGGAACAGGGAGTGCAGTACCATCGAGGTAGACGAGCGCGACAGTGCCGTATTTTGTCGATGTCTCGAGAAAAAATCC
TGTGAGTTCCTTGTGGTTGACCTAGAGCCAAAACCGTGTGAACTCAAACACGTCGCCAGAATACAATCCAAATCACACTCACCTTTCTCAAGTCGAGTCG
ATGCTGATCTACGGGCCGGCATTGTGAGGGGAGATCCTTGATCGAGAACCGTTGCAATTCCTTAACAGGATTCAGCAAGAAATGACCAACCAAGGTGGAG
TGGTCTGAATGATGCAATCAAAACAAAACAAAACAAGCTGGTGTTCACAACGCTGCACTGCAACTACCCTTCTGCGAGATATCCTACCGCGAAATGGAGC
AAACCATTTTACCGACAACCCGTTTGCGATCGAATAGAACCGCTTCAAGTCGTCTGGAAGTAGATACGGGGAGTTTTTCTGGAGCAACGCATCAACGTCA
GCATGAATATCTTTTTCTGTTCTGGCCTCCCTTCAAGGTGTACACCTGCTCCCAGAGTCCAAGTTCCACCTGGGTAGCCCCAACAAACGGCTTCGACTCG
ACGCGCGACACGCGCTCATGAGCTTGCAAGTACGAAAACACTCCGAGGGAAATGGCGTCCAAATGCTGCATTGGTGCTGCCGAAGAATGAACGAGCGCTC
AGATTCTAAGATAAGAGCTGCACGGGAACAGGCGGAGCCGGCGTTGCAATCCTCTAGCAATATTACGACGGAATAGCAGCTATTACAACGATCCCTGAAA
GTGCGACGAGGCTCGACTACATGATTGAGCACTGCTCTTGGCCTGGGCCGCCACCAACTAACCACAAAATCAGCAAGAAGCAATCAAGAATTAGACTCTC
TCCTGGACAAAGTATCAAAAGTTGGACTTACGTGGCATGCCAGGCATTCCAGCCATACCGGGGAACATGCCAGCGCCCTGCAGAACCCGGACATAACACA
GTTAGACCCTGTACGTAGTTTCTGCTCCAACGTTGTAAAGTAGAACGAACCATATTCGGCATAATCGGCATCCCTTCGTCATCAAACTGCAAGCCTGTGC
ACCGAGTTGAATAAAGTAGAAGTAAGACGCTTCTTTTCAAAAACAACAACATTGACTGAGGCGTACCTGGGGCAAGGTCCTTCACGATCTCCGAAGGCGG
TTGGCCGGTCTCCTGCATCTCCTGCATAAGCTCTGACAGTCGAGCGTAATTATCCGGCTCTGACTCGTACGCTGCGACGATCTGCTGGAAGTACTGGTAC
TGCTTGCCATATCTGCGCAAAAAAATAAACAGCTCACATTCAGGAAGGCAGTCGACAGAAAGCACACACGGATACACAAATGCCTACCGCTCGTAGTCTT
CTTTAGACAACAGCGACTCTTCTCAGCTAGCCACTCAGGATACTACGCAAAAACGCAAAAAAAAACAACAACTCGTGATTAGCCTCCATCAAGCAGCAAA
GTCATACCCCTTTCAGTACTTGCGTACCCGCTCGCAGATCTGCTTCATGGGATCATACATAACGTCCTTTGATAGCAGTTGCTGCATCATGCCGTCCACC
AAGTCCTGGAAATCGCTCTGCCCCCAAAAATCACCGTCAATAACCAGACACAGGAAGTCACTCAACTCCTGTAGCCACCGCACCTTTTCGCCCATCTCTT
CAAACTTCTTCATCATCTCCGACATCATATCCTCGCCCATAGCTTCCACCTGGGCCGTACCGACGCCCTCCATGTCTTCCGCCGCCTTGGCCATATTCTG
CAGCGTTTTGGCCACGCCAGCGTTCACATCGTCCGTCTCATCGGGCGTCGCGTCCACCTTCAACGAGCCCAGCAGCTGCTCGATGTTCTCGGCGTCGTCT
GCATTCACCACAAGAGCATCAGAACCTCTCCATCAATCTCTTCACTTGACTCCACTATACCGTCCGTGCCCAGCTCTCGAAATGCCTGCTCCAGCACCTG
CTGGAACTCGGGATTCTGCGCGTCCTCGAGGAACTTAGCCATGTTCTGCCCCCATAACCACAGCGTCAGCGCTTCACTTCGCCTCGATCAAGTTCTTAAC
AGTTTTGATAACCTCTTGCAGTTTGTTGTCTTCGCTGTCCCGCGTCGCAGCAGCGGTGGCGGCCGCTTCCTGCTGCACGGTGGCCATCTCCGAGGCTTGG
GCGGTGCTCACCTCGTCCGCAAAGTCGTCCAGCGCATCTGCAGAGACGGACAGTGAGCGGGTGTGTGTGTAGGTGAAGGAGGCATGGGTGGTTACCTTCG
AGGAGATCGTCCAGATCCACTTCCTCCTGCGTCTTGGGCTCGCTCTCCTCCTTCGTGCTCATCGTCAGGCTCCGGTTGACGT