Description :
From Genome Similarity Track
Location :
Scaffold_63:152756- 157596
Transcript NameFunction/comments
Aphas_H257_15095FTO, partial

Sequence
4840 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNTTGCTTTACGTCAACAGGTCAAGGTGCTTGACGCAATGAAACTGAAGGAGCTATGGCCACATACATAACCTCCCATCCGTGATCACTACAGTACTA
ACATTATCTACTCCGAGTAATGTATATAACGTTAGGGATATAGTTAGGCTACAGTACACGTAGTCGTCGCTCTGTCCAATGATTCAAAGCTATGCCATAC
CTACAATTCTTGATCTGGTCTAACCTGAGCACTGTACGTGGAAGGCAAGACGACAACACGATGTATAGTACTCCCATTTCACAGCCTAATACGGTATGCA
TCGTGATGAACTGGTTGTTGTACGGCGTAAGTTGGCCTGGTGCTGCAACTCGATTAGTTAGCAGCTGAAATAAAGTAAGGGTTGTTTTATTCTGCTGAAA
TGCAGAACTTATGTTTAGGGTTGTTTTATCTTCAATCGGGCTTATATTATTTTAAACGTCTGGTTGTTTAACGCAGTTAAACAACGGGCAAACTGCATGA
AAAGCACAATACGTGGGTGCATGTTTAAAAGAGGGGTTTTAGTCCCAGAATAGCCAAAAGTTGTGAAAAGCACAATAACTTCTGTACAGGTTACTATAAC
TACTAGTACAGTGTACTCTGTACGTTGTTGTACTTCGTAGTGTTAGAATACGATATGAATGCGAAGAAATATGAGTGAGATATCAAAGGCGACAGACGAC
AGGTGATCTTTGAAAGGTGCAAGAGTCTTCGAGAAAACCTGTGCTATTAATAAGGGTCTGGTTGAAGTAAAGAATCACCCACTTTTTCAGCACTCACTTT
TCCTCCTTAACTATGTGGGCACTCACTTATATAAAAAGTTTATGAAATACCAACTTTTTGAAAAAGTGGTGGTTTGACTTGAATTTGAGTGGGTATAAAT
TATCAACAAGTTATTAATAATGAGGTGAAAAGTTGGCCCATATTATGATTCCACATGACAATAATGGGAACTAACTTTTAGCGTGTTTACGCTTTATTAA
TTTTGTTGTGCCGTGTGCCCGCGTGGATCTTCCACTGCCTCTTCTTTTCACTCTCCAACACTAGTTTATGCGCATGGAGCGCGGCGATTGTCGCCGTGAG
ATCCTTTGGCAGCAAATGGACGTCGTCCCAATCAGTCCACACTGGCCGCTCCATCGGCTGGAAGTCGGCGGCGATGCGCTTGAACACTTTGTCCTTCATG
CGATGCACGAACTGGTCGCGGCCCACTTGCCGGTTGCGCAGACCCTCCAGCACGGCCTTGAGCACCTTGAGGTCGTCAACGTCATGCGACTGAACGAGGG
CGTCTGCCAACGTTTTCGTGCGCGCTTCGAGTTTGCGCCAGCTGGCTTCGAGGGCCAACATGGGCTGCTGCCAGTCGACATGGAGGTCGTTGTGCTTGTC
GCCTTGGATCCAATATTGGCGCAGCCAGTCCATTTCTAACGTCGTTACCGTCTAATTTCCCAAGAATAGAGTTCAGTTTTCCATCAAATGTCCATATTAT
AAACGCATACTAGTTACTGTACATACAACAAACACATCATGCACTGTATGTATGTATATATATATACTACACTATACAGTAGTGAGATTGCACTACTACA
CTGTAACTGCAAGTTACGTTGCAAATTGCAGATACATGTATTTATTTTCCTTGCAACACTATTCAAAACAAATAAAAATATGACAAATATATTTTTGGTG
CCACAAAATTTGTCAGACAACACCTTGTTTTCGCAACTGTTGTCCGAGAAAAAAATTATAATATACCTTCTTTTCAAAGAACGTCGTTTGTGGCTTTGGC
TACCACATCTGACAGAAATATATGGGCATGATACTTTGACTGTTTTCTGACAGAAAAATAATCAAGTGCAAGCAACATTCCAATTTCTACGAGATTCTCA
TATGTTTTCACACCCGACGAGGTCTCACCAAATAATATTACTTTTCAAATCTTATATAGCTCCCATTTAGGAAGGGAACATGCTCTGTCCGAATACGCGA
TATATTTGTCCCATAAACCTATCATCCAGATTTCTCGACCTTACAACGACCTGTAAAACCCCAAAACACGAAAAGAATCAAATATATTATTTCTTCACCG
TTGAATGAATCGACATAACCAAAGGAACAGAAGAATCATCGGCAGAAGGATTTAGCCAATCAGATTGCAGGAAACAAGCACCAACTTCATAATTAGTGTG
TGATTTTTATTAGTGTGATCAACTTTCGAATTAGCGTGTGATGTTTATTCGTGTGATACCAGTCACCACAAGACGACACGTGTTTACATACAAAAGGCAG
TACAAAGAATCGATCGATAGATTTGGCAAAGAATCCGCACAAAAGTTAGCCAAATTTTGGGTAAAAGAAAGGCATTCTTACCGTTTGCTCGTGCCGAACG
TCGTCGGCGTGGCCGCGACGGCACTTGTCCTGCGGATCCTTCGCGCTACTCTTCAACGCGGCGGTGACTTTGGCCTGAATGTACTGCAACGTGTCTTCGG
CCGTCACAGCCACCCGATGCGTGCTGCTCACTCGGACAGCAGTGCCAGAGAGGACCATGTGCTGGTGGTGATGGTTGAAGTCTCCGTTGAGGTAATACAC
ATCGCCATCTCCCGTGGGCACCACCAACGGCGGGGTCGTCTTGGCGCCAGGTACGTCTGGGGACAGCCTCATAGCGATGCGCCAGTCGCACGGCCCTTTC
TTGCTCTTCTTGGTGGGGAGCAACGTGTGGTACACTCCGATGGACGAAAAGTCCTCCAGCGACGAGTCGGCGTGCCAACTCACGCTCACTTTGCCCATAT
CGTACGTCAGATCGTCCTTGAGCCCCAACACCGGATTGTCCGGCTCCATGTAGTTGATCAACGTCAAGTTGTACTCGCAGGATGGCGGCGCCGGCGACGC
GGATGCTTTGGTGCGGGCCACGATGGCCTGGTTCAACGCG