Description :
From Genome Similarity Track
Location :
Scaffold_3:152731- 154263
Transcript NameFunction/comments
Phyin_T30-4PITG_02092Electron transfer flavoprotein-ubiquinone oxidoreductase%2C putative

Sequence
1532 bases(100 bases per row)
ACCGTGAGGATGGCTCTGTGGGCGGCATCGCCACACGCGATGTAGGCGTTGGCAAGGACGGCAAGCCCAAGGGAACTTTTGCTCGCGGCATGGAACTCCG
TGCTCGTGTTGTACGTACATAATTACTATGGTGGAGGTTTTATTCTACAGGTGCTGACAGGTATTTGATGTACGTTTGCTACAGACGCTCTTTGGTGAGG
GTTGCCGTGGCTCTTGCAGTGAGGAGGTGATGGAGAAGTACAACTTACGCGAAGGTGTGCAGCCCCAGACGTATGGTCTCGGCGTGAAGGAGGTGTGGCG
TATCCCTAAGGAGAAGCACCAGGCTGGCCTTGTTCAGCACACACTCGGCTGGCCGTTGCAGCAATCGGTGATGGACAAGACTTTCGGCGGCTCGTTCATG
TACCACATGGAGGACGATCTGGTGCAGATCGGTGTGGTTGTTGGTCTGGACTACGAGAATCCGTATATCAACCCGTACGAGGAGTTCCAGCGGTTTAAGA
CTCATCCAGCGATCCGAAAGTATCTGGAGGGCGGTGAATGCGTCCAGTACGGTGCTCGTTGCCTGAACGAAGGCGGCTACCACGCTATCCCGAAGCTGAC
GTTCCCTGGTGGTGGTTTGATTGGTTGCTCGGCTGGTTTCCTGAACGGCGTGAAGATCAAGGGCACCCACACTGCTATGAAGTCGGGTATGCTTGCTGCT
GAGGCTGCTTATGAGGCTCTAACCGCCACTGGTGCGGATACCGTCGCTGAGACGGCGGAGATCAACGCTGAGGAACCTGCTATTGACATCTCGAGCTACG
AAGCTGCAGTGGAAGATTCATGGATTGCCGAGGAGCTCAAGGCTGTTCGTAATGTACACGCTGGTTTCCACAAGGGGTTCCTACCTGGGCTGCTGCACGC
TGGAGTGGCGACGCACGTCCTCAGAGGAAAGGAGCCGTGGACTCTTCCGAACACCGAGCCAGACTCGGCCAAGACGCGTCCGGCAAAGGATTTCACACCC
ATTGAGTACCCGAAACCGGACGGCGAGTTGACATTCGACCTGCTCTCTAATCTGCAACGCAGCGGTACCAACCACAACCACGACCAGCCAGCTCATCTGC
GTATTAAACCGGAGCACACGGAGGTTCCCTCGAAGGAATCGTTCCCGGTGTACGCTGGCCTAGAGCAGCGGTTTTGTCCTGCCCGCGTCTACGAATACAC
TGACGGCAGCGAAGCCAATGGCGTCCCGCAGCTTGTGATCAACGCCCAGAACTGCGTCCACTGCAAATGCTGCTCTATCAAGATGCCCAAGGAGTACATT
AACTGGACTGTCCCTGAAGGCGGAGGCGGCCCTGCTTAGTAAGTGGATACTGTGACGGATGCTGCTGCTAGAACGTCTTACTGACTGTTGTCTGTTGTTT
TTGTGATTGTACAGTGAACTCATGTAAGGACCTTTTGAAGTAACACTTTCGGTCTAGGGGCTTGAAGTAGTAAATATTCAATCAAAGATACGATTGGTAC
GACGAATCGTCGCGCGAGGTGGAAATGTATTG