Description :
From Genome Similarity Track
Location :
Scaffold_35:152715- 153721
Transcript NameFunction/comments
Phyra_47865heat shock protein 70

Sequence
1006 bases(100 bases per row)
GTACATCTTCTGCAGGATCGGATTCGCCACGCCCTCCAGCTCCTTCTGCTTCGACTCGTACTCCTCCGTCTCAGCGGACTGGTTGGCGTCGAGCCAGTTG
ATGGTCTCGGTCACCTTGTCGTCCACCACCTTCTTGTCGGCCTCCGGGATCTGCTCCTTCAGCTTCTCGTCGTTCAGGCTGTTGCGCAGACTGTACGCGT
AGTTCTCGAGCGCGTTCTTGGCCTCGATGCGCACCTTGTTGGCCTTGTCCTCCGACTTGTACTTCTCGGCCTCCGCCACCATGCGGTCGATATCGGACTG
CGACAGTCGGCCCTTGTCGTTCGTGATGGTGATCTTGTTCTCCTTGCCCGTCGACTTCTCCACGGCCGACACGTTCAGGATCCCGTTCGCGTCGATGTCG
AACGTCACATCAATCTGGGGAACACCACGAGGCATGGGCGGGATGGCGTCCAGGTTGAACTTGCCCAGAAGATGATTGTCACGGGTCATCGAGCGCTCGC
CCTCGAACACCTGGATGAGCACACCAGGTTGGTTGTCCGCGTACGTCGAGAACGTCTGCGCCTTCTTGGTAGGCACCGTCGTGTTACGCGCGATCAGCGT
CGTCATGACACCGCCTGCCGTCTCCAGGCCCAGAGACAGCGGCGTCACGTCCAACAGCAACAGGTCCTGCAGCTTGTCCGACGAGTCGTTGCCGCCCAGG
ATGGCCGCCTGTACCGTTGCGCCGTACGCTACGGCCTCGTCCGGGTTGATGGACTTGTTGGGCTCCTTGCCGTTGAAGAACTCAGACAGCAGTTGCTGCA
CCTTCGGGATACGCGTCGAGCCGCCCACTAGCACCACCTCGTTCACCTGGCTCTTGGACAGCTTGGCGTCGCGCAACACCTTCTCCACGGGCTCCATGGT
CTTTCGGAAGTAGTCGCCGCACAGGTCCTCGAAACGGGCGCGCGTGATGGTCGAGTTGAAGTCCACGCCGTCGTACAGCGAGTCGATTTCAATGTAGGCC
TGGGCC