Description :
From Genome Similarity Track
Location :
Scaffold_409:1527- 7671
Sequence
6144 bases(100 bases per row)
CATAGCGTCGCGTACTTGACGCATTACGCTCAGTCTCAAAGCGACAAAGTCATCGACTTGCTTGCGAACCGCAACAGGGCTAACATCAGCTAGCCGCTCG
GCTATCCCTCCCCCATCAAGGCCTGAGGCCCTGCGTGGCGGCGTCAGTGGGACGCGAGGGTTAACCAAGCTGTGGTGAAGTGCTTTTTCAGAAATAAGAG
AATGGGCCTGACGCGGGGTCACTATCCCGAATCAGTGACAATTTCAAGTGATTAGAGAGGATTTGGGTTGGCTGGCACGGATGCAAGTTGCCTGTGGTGG
ATTAGCCATGACGAGCAGCACCCCGTATGAAATGACGATGGATCTGGTATGAGCGATGTACGAGAAGACAAGATCCACCAAGACTTACCTCAGATCCACC
CTTACCTGGATTCACCTAGATGGATATGGGATATACTATACAAGAGTGGATCGGGTGTGGATCCTATGAAGGAAGGATGGTAGGTGCCCTCGGAAGGTGG
ATCTAGCAGCCACGGCTAATGAGGAGTCAAGATCCACCGCGAGGTACCCCGGATCCCATACTTCCGAGCTCGGATCCAAGGAGGGAGGATCCCGCCTGGA
GGGACCTGGATCCAGGGTACAGGAATGATGGATACAGTGGATCTCGAACTTTCGTGGGACAATGGAGATCACAGACGGTTGCGAGATGATGTTGGATGAT
GGGAGAGCTCAGATCGACGACGAGTGCAAACTTACAGTGAAGTGGATCCAAGCGACCTGGATCCGGATGAGTGTACCCATAATAGGGTGACCATGATGAT
TACGTCATAAGATCCGGTGGATCTGAAGATAATACAGCTGGGATGATGGGTCAAGGGAAGAAGGGACATGCAGCCGAGCCTGGTAAGGGATTTAGCAGAT
GAAAGACATAGAAGGTAGAAATCCAGGCAGGTATAGGCTTAAATATCAATACACGCAAGTGCCTTCCTGCCCTCAAGAACCGGAACTACATTGGCCGAAC
GAGCTCGAAGAAGGTTGGGAATTGCGAATCTAGTGTTGGTAGCGATAACTGGATAATACATTGGCCAGATCCTACAACCTAGTGAGCTTTTCCTTTACTT
GTGCAGATCCGACAGGTTAACCGAATTTACTACTTGGGTCGGTTACACCCTAGAAGTTCTCAACTTTCAAGATCCCGTCACAGGAGGCGGCAAGTACGAC
GCAAAGGAACTACAAAGGCAAGGGAACACACCCGCAAGGCAACCCTACGGCCAGATCCACGATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAG
GATACGGAACCATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCCATCCCCACGTCTCGCCAAGACACTCAAGTTTCACTACTTGAACTC
CTCGGAAGTTTTTCGATGAGCACAAACCCCCCCCCACAGAAGTGGAACCCCGGGGGGAATTTTAGTTTTGCAACACACGGACCTCGGGGGACCTCCTCCT
TTAATCGGTGTCTGGTTGCGCTGGTAATTTGTGATCCAGCATTCTTGCAGATTTTTGCTGATCCCGCTACACCACATCTGTGTTTCCTTTGAACGACTTT
GATCAACGAGGGGATATGATCCATGGCTATGATTTGGAAAGGGTAAGTCTGCTTGTACATTTTCCAGGTGACTCCCCTTCGATTTGTGGGGCCTGCCCCT
TGCCCTGTCTCCACAAATCCACACATTCTGCCGACATTATCGCTGTACTGCTCTTTAAATAAGTCCCCCTCCCNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCACGATTGGAGCCAGAATCCGGCAAG
AAGCCAGTGGGATTATCGTCAGATCGGGCTCACGGTAATCGCCTCACGGATCCGGTCTCGCCAGGGGACCAGACGGCCACAGGCTCTTCCGAACACTTCC
TGGGGCACCCTGCAGCGACACTTGGGAAGCTGCGATGAGTGCGTTCCCGACCGAAACGAGGTTTGGAGAGGCGCCCTGCCCCCAGATGGCAATGTCTCCC
CGCAAACAAGAGACCCCGCGGGCCGGGAATGGGGATTTCCGGGGAGAGGGACCCAATCCCCACGAAGAAGTTGGCCCCCACCCCCGATGATCAGGAGGGC
CCATCCCACCTCGTCAGCAGTGGTAGCTGCAGCCACAGCCGGGGCCGGTGGATCGTCCATGATCCAGAGGTACGGATCTCAGCCATATCGGATCTAAAGG
AGTTCACGGGCAAGGATCAAGATGAGGACCGAGCGAGAACATGGATCAGCCAAGTCACGTCGGCTCTCATGAGAGATCAATCGTCGGATGCCGAGAAGTG
TTTGACCTTTGCGGATCTGCTAGAGGGGCCAGCCAGGAACTGGTATCGGCAGTTGGGCAGATCCACCAGGAACTAGTGGCCAGATTTGCTGCGAAGCTTC
CAGACCCAGTACTGTGGATTGGGAGTGTCGGTGGCACGACAATACTACCACGCTCGCCGCAGATCGGATGAATCCCCGCTAGAATACCTACATCGACTAA
ATGTGGCCGGTCTACGGGCCAAGTTGAAGATCAAAGATGGGGGATCCAAGGTACTGCGGGAACACGTGGATCATTTCATCGAGACGGTGGGAGACGTGGA
TCTGGCCGACAGGCTGACCCTGATACGACTTCCCGACGCAGACGAGCTTGAGGAAGTGGTGCGGGCGGTGGATCGCGCGAAACACCGCCAGAAGAAGGCG
GCGGTCGGATCCGGCAAGTATCGCCAAAAGGCTCCGACGCCTACGGCCCCAGCTCGACGTGTCCACCAAGTCACGGCGCCCGACTCAGGAACTGAATCAG
GATCCGACGGTTCGGACTCCGACCCTGAAGATTACCGTCAAGTCTGTCTCACTGCGTCCAACGAACGAACGGCGAAGACAGGAGACAGCTCTCGACCGGG
GGATACCGTACCCGGGGACCGTGGGATGTACAGATCCCGAGATCTCATGGACGGGGCAGCACAAGTCAAGTGTTCGCAGTGCGGATCCCGGAAGCACACT
GAATCTGGATGCTGGAAACATCTGGTCTGTGAGAAGTGTGGCAAGAAAGGTCATCCCGGGGATCATTACTTCGACGTGTGTCGCGGGTGTGGCGAGATTC
ACGACGTCGGCAAGTGTCCGATGGAAGAATTCTACAACCAGACCCGCCAATGGTTTGATCCAGCCAAGCACCGAGGGATGTTGCCAGAAGTGGCCGAGAA
AATGTTAAACTAGGACGCTCGCCGGGTTTGAATCCGGTACGAGCCGAGCGTTCTAGGTACTGCATTTATGCATTTGTGAACAAGACATCGCTAGATCCAG
GTAGCAGGACCCTAGATCCAGTCGACAATACACGTGATCTACATGAAGAGTCAGTTGCCAAGGTCTCTAGTTTGCGCCAAGTGGATGAATTTGCCAGATC
CGAAGTCTCTTCAATCCTGGATCTACAAAGGGGAAAGGCACGGGGTTATTGGGAGAAACGCCAACATGGTCGATGGTTTGAGCCTACCAAGGGTGAGGTC
ACTGCAGATCCACCTAAGGTCTGTCTGGTCACTGGATCCTGTGGATCTGAGGATGTTGGATCCATGGATCTGCTAACAGGGGAGTCCCGTGGATACTGGA
AGTACCATGCCCCTGGAAAGTGGTTCAGACAAGCCAAGGTAGGGGGCAAGATCAACAATGAAAAGGCTATCCTACTCCTAGATAGTGGTGCCGAGGTGTC
TATACTGGATACCGCCTTTGCTCGTAAGCCAAGTGGATGGGAGTCGAATCCAAGACTGTGTTGGGATTGGTGAAGACGTGTACCGTACGAATGGGAGAAC
GCGGATCAAGATCACGCTGGCAGGTTGTTTGGTGTATTGGTTTGATATTTGGGTCGGGGATCTCGCTGGTCAAGACGCCATCCTCGGGATGGATTTTATG
GTGCCAGCCGGAGTGAGGTTGGATCTGGCGGATGGGACACTTTGTTTCCCTGACGAGATGCGGATCCAGCTTAGCGGACGGCGGCCGTTATATGGGGCGA
AGATGAGGATCATAAGGGCGGACAAGACAACCTGGATCGAGCCCGGGGAAACCTGGGAGCTGCCAGATAGGTTAAAGTGGGTGGAACAAGAGAAACAGTG
GGTCACTCGGGGCGAGAAATGGGTGCCTACCGTAATCCAGGGACCAGGTCGATCACAATACCGCCAGGTCACGAACGTCAGCGACAAGAGACTATTACTG
GACCATTATGAGGAGATCGGGCGATGGTTGGCGAAGGACGGTATCCCTAGGCGACCTGGATATGTGTCAGTGGGATCCCGCCGCTACAAAGAATGGCAGA
ATCTGGCGTACGAGGCGACTACCGAGATCGAATCTCTCGGAGAGGCTCCCGGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN