Description :
From Genome Similarity Track
Location :
contig_12:152690- 157779
Transcript NameFunction/comments
g3749.t1hypothetical protein
g3750.t1ETP44728.1 hypothetical protein F442_08733, partial [Phytophthora parasitica P10297
g3751.t1ETI46887.1 hypothetical protein F443_08792 [Phytophthora parasitica P1569

Sequence
5089 bases(100 bases per row)
GCGCGATTAATTGCTTAGTGGGGCAGTGTTATTAGAGACAGCAGCCATTTGCTTACGCTGTTGCGAACAGATCGCGGGATATCCATGTGGGGTAAGTTAC
CCGATTGTCCGATCGCTCGACTGGACTATCGACGAGCTTACGGCCGGCAAGATCACATGCTTAACAGCCAGAAGAAGTCTGCTCAGAGATGAAACAAACC
TTCAACTTGTTTAACGTTTAATGAACTGTATCAAAGGTGTAGTAAACTCAGAAGCTAATTTGCTGGCATGTCGATCTTCTCACTTGGTCATTCGGACGAT
CCTCTGCCGGTAGAAGTTGTCATGCAACGTGGCTGGACGTCCTCCGTTCTTGTGAAACAGCATCTCCTCCTTATGCAGTCGGTCCATCTTGTCCAGATAC
ACGGTCGCAGCATGGCACACCTTCCTCAACTCACTGCTGTCCAGCTGCTCGGCCACTCGCTCCTCTCGACGCAGGATCCTCCTCGCGCGCTTGAACTTGC
CCAGCTGCAGGGCGTTGTACATCAAGTTCACTCTGCACTTGCTCTCCAGCACGGGGTCCTGGAGCCCCATGGAGATGCCGATCTGCAGCTTGGCCAGCAG
CGTCGACTGGTTCAAATGGCGACACAGGAAGTGGCCGCCTCCTAGCGTCGAAATGTACGCGTTGGCCGTGACCAGCGCCACCACCGCATTGACCAGCTTG
ACGGCGCGCCTCGCTGATGCCATGTACAATGGCAGGAGCTGCGTGGGTCTGTACGTAACCAGCACCAGCACTCGACGAGTGTCTTGAGGGCTCTCCGCCA
CGAGGTAGCGAGCGGTGGCGTCCTCCCAGTGGATAATGTTCTTCTGGTTGGTCTTCAAACTGATTCTCTCCACCAACAGCCTCGAAAGCTGCTGTGTCTC
CTCCGGATACATGCAGAGCCCTCATCCGATAGTAGAAAGGTCACAAACTGGAAAACCTCCGCGTCTGCGATGGCTACAGAGCCGCAACACACGGAAATTA
TATGGGGAGAAGTGCAACATTTGTGTGTGAAGCCACGGTACGTTTCAATGCGCGCAAGGCTCTGCGCTCCTGCAGCGGCGCCTCGAAGGCCACGACGCTC
AGGCGGACACCCAGTGCAACACCCGTCATCTTCCGAAATGGATGCATGTGATCGGATTGGATGTAAAGAAGTTCATTAATAGCCAATCGGAGACAGATGC
ATCTTGAAGCGACGCGTGCGTTTGGCTCGGATATCCTCATCGGCCATGTCGCTCTTCCAGGTGCGCGAGTGGTGGGCCGCCAAGGGCGAGAATGACGAGG
AGTATACTTCAGGGGCGCTGGTCGTGGGCAACGTGGACAACGACGCGTCTGGCCATGGTAAAGTGCGAATTGTTGCAACTGTGGGGGGTCTCGTCCGCTG
ACTGCGACACACATTCCTACAGCGAAGATCGTGACGGGCAGTTTGAACGGCGTGTTGCGCGTATATTGCCCCACGCAGAGCGACTTCCGCATCGAGCATT
TGCTGCTCGAAGAGAACCTCCGCCGCCCGATTCTGCAGTTGGCGCTGGGCTACTTTATCCCGTGAGTCTGGTGGCCTCACGTGCAGTGGATGAAACAGTA
TAGCTGATTTTGTGTTCTGTACGGCAGGAACCAACGCATCTTGGCGCTGGCCATTCTACAGCCGAGGAGGATTGGGGTCTATGTGGTGGAAGGCATGGGC
GGGACGGGGATGGCGGCGAGTTACTTCAAGATCACACTACGATACGAACACCTGTTGGGGATCGATGGCGAGCATTTTACAGCGTACAACTTCATTTACG
GGCCGTTTGGGTCAGCCAGCTCGAGCTCTGGCGGAGCAGCTCCTGCACGCTTGGAGAAAGATCATTTGTGCGTGCAGTCGCTGGATGGGCGGCTTCAGTT
TTTCGAGCAGGACCGATTCGCATTCCTGCAGCCACTCAACAACAATTTCTTGCCGGGCGCGATATGCTATGCGGCTGGCATGGACGCAGTTATAGCAGCC
ACGTCAGACTTGCAACTTGAGTGCTACCGTTACCAAGTCTTGGCCTCTGCCTCGCTAAAGAAGAAGAAGAACGCGCTGGATGAAGACGGTAAAGAAGACC
GACAAGGGGATGCCTCGTCGGCGTCCGTACACTGCGATTGGAAGATTAATATTGGTGAAATCATTGTGGATGTTCGAGTGGCGCGAACTTCATACCAGGA
CTCGGCAACCAGCTTTGACATTCTGGTTCTTGGAGAATTCACGCTTTTTGGTATCAAACCCCAAGGAGAGGTATATCTGCAGAAGCGACTAGGCTTTCAC
CCATCGGCATTTTGTCCGTTCCAGCGCTGGGCATCACCTACCGAGCGGGGTACACCAAACACCACTGCGCTGGAAAACCTGCTCGTTGCCAGCGACACGA
AACTGTGGAGTGTCTTCAAGGACAAAACACTCATTTGGTCTGCTTGTTCCTCGGTGGTTCCCGTGGCCCTCCAGGTCCGAATTTGGCGGCATAGATGGAA
TGATCGTGAGCCTCGACTCGGATGGAGCGCTTTCTGTGAATTATATGGGTACAGATCCGCCGTCCTCCGCTGTTGTTGCACCAGACACAAAGGAAATCAA
CTATGAAGAGATGGATGAGGAACACCCACAGCTACTGAATGTCATTCGACGTGCACAAGGCGAGCGACGGACGGAGCCGAAGGATCGTGTGTTGATCCGA
GCCCAGGTGCCTGCAATACTGGATGCACTACCGGATCGGAGCGACGAGTTTAGTCGTGGAGGCGGGAGCCCCGTACATGATGGCAAGAATACACAGCTGA
CGATGCGCGTGTACGTCACGTACACGGGTGCCAACCGTGTGTCCAATGTGACGCTATCGGTGTTGACTCCCGAAAATGTGGCGGCTAGTGACTCCTCCTT
CGTGATCGGGAGTATCGATGGCAAGGCATCTACGCCGCTCATCATTCCGGTTGTATTGCGCCCAAGTGCTGAAGCAATGCCAACCTCGTTATCCGTTACC
ATTTCAGCATCCTACACACTCGAGACAGGGCAGCCTCGTGTCTCTCAGTGTGTTGTGAAGTTGCCCATGTGCATGGCGTGCCGCCTCGTGCCTCCCGTCA
AGTCGAGCACCTTTAAATTCACCCTCGAGACTAATCAAGAGCCGCTGGAACTTGCTAGCCTGTTCGAAGACATGCTTCACCAGCCAAGTTGCACGCCTGA
GTGGGCAAAACAAGTGGTGGCGGGAGGATCCGGTACAAACGTGCTGAGCTTCCAGTACTACAATGGCGTCGAAGCCACGATTCTCGTGTCGAAGAACGCT
GGACGGTACCGCATCCAGTCGAACGAGCTCGAGGCGCTCTGGATGGTGTCACAAGAGCTCGTTGTACGACTCCGTGCATACTTTGACGGTCGGGAGCAGA
ATGCGGAGGCCAAGAGCGGCGGAGGTGGATCCTCCTCGTCGGTGTTGGAGGTGTTTTACCAGGAGCCCCTCCCGCTCGCAGATTTCTTCGGCGCGATTGA
CGCGCACTTTGCTCTGCGAAAGGAAAAACTTGAGCTCGCGGCGCAGCTGAACGACCGAGCCCACCAGTTCCGCGTCATCCAGAAGCGGTTGTTGGTGCGC
TACAAGGATCGCAGCCCCGCCGCTGTGAATTATCTGGACGTGCTGCTGCACGGCACGTATGACCAACTCATTTCGTTGTCGCACGCCATGGAGGCTGTGG
AAGTCAAGCTCAAGCGCGCGGCGAACCGATTGTCGTGCTGCGTGTCGCTCATACTGATGCTCATTCAATTCCGGTTCCACCTGAGCGATGAAGACGCGCA
GCTGCTCGAGGCATATCTGTCGCCCGTCGTGAACGAGTCTGCCGACAGCGGTGCCGTGGAGCAAGGCTGGGAGGAGCGGACCGACTGTGCCATGACGGAG
CTGCTGCGCACAGTGCTGGCCAAGCAGCCCCAGAACAAGGACGGCGCGTCTGCGACTCCTGCGCTCGCGACGAGCGAGCTGCAGATGCAGGAGGACACCA
AGCGGCTGAAGAAGCACATTACAATCGTGTGCGACCGTCTCGGCAAGGGCGCGTCTCTGGTCTCTGGCAGCAACACACCGCTCCCGGCAGCGCAGCACCA
CCTCCCGGCGAATCGAAGGGAGACTAGCGACAGAAAATGCTCGCACAACATCATTTAGCTTTCGTCGTGTGGAGACTGCATCCTAAAACTTGAGGACGAT
TTCAATTTGACTTGCCAGTTGTATTGGTCAAGTTGAAGTGGTCGTGATTGCCAATATCATCTCGGATTGGTAGAAACAGATAGAAATCAGATGCTGTAAA
TTCTTCCATTGGCTGAAATGACTGCGTAGAGTGTGTACTTTTCGTAACTGCCGTCTGCTCCAAACATCCTCGATGATCTGATGCTCTGCCTTCTTCCAGC
CTCACCTTCTTGTCTCTCTCTTGCAATGATTGCCATCAGTTGCTCGTCTGCCTCACTTGCAACTTTCCTGTCATTGACGCAATTCAAGAGACCAAGATGA
AGGTGGCACTGCAACTGCTCGCGAGCTTCGCGGCGCTGCTGGCCGTGACTTCGGGCGCCCGCAACGACGACGCACTGGTCAAGAATCTGCCGGGTTTGAC
CCGAAAGCTGCCGTTCAAGCATTACGCCGGCCACTGGAGCTCGAGGAGAAGGAGAAGCTCTTTTACTGGTACACGGAGAGTCAGAACGACCCGGAGAACG
ACCCGATCGTGCTGTGGCTCAACGGCGGCCCGGGCTGCTCGTCGCTCGGCGGCCTCTTCACGGAGAACGGCCCGTTCGTCGTGCGTGACGACCTCTCCAT
CAAGGTGAACCGCTACTCGTGGAACCGCAAGGTGAACATGGTGTGGCTCGAGTCTCCCGCAGGTGTGGGCTTCAGCGGACCAGTGGAGGGTCCCAACTAC
TACAATGATGACGTCGTGGCGGCCAAGACGCGCGAGTTCCTCGCCCTTTTCTTCAGAAAATTCAGTGAGCTCAAGAACCGCGACTTTTACATCACGGGTG
AAAGTTACGCTGGCATGTACATTCCGTACCTGGTGGATCGCCTGGTGGAGGAGCCGATCGAAGGTGTCAACCTCAAGGGCTTCGCAATT