Description :
From Genome Similarity Track
Location :
contig_12:152679- 157770
Transcript NameFunction/comments
g3927.t1hypothetical protein
g3928.t1ETP44728.1 hypothetical protein F442_08733, partial [Phytophthora parasitica P10297
g3929.t1ETI46887.1 hypothetical protein F443_08792 [Phytophthora parasitica P1569

Sequence
5091 bases(100 bases per row)
GCCCTGCGCGATTAATTGCTTAGTGGGGCAGTGTTATTAGAGACAGCAGCCATTTGCTTGCGCTGTTGCGAACAGATCGCGGGATATCCATGTGGGGTAA
GTTACCCGATTGTCCGATCGCTCGACTGGACTATCGACGAGCTTACGGCCGGCAAGATCACATGCTTAACAGCCAGAAGAAGTCTGCTCAGAGATGCAAC
AAACCTTCAACTTGTTTAACGTTTAATGAACTGTATCAAAGGTGTAGTAAACTCAGAAGCTAATTTGCTGGCATGTCGATCTTCTCACTTGGTCATTCGG
ACGATCCTCTGCCGGTAGAAGTTGTCATGCAACGTGGCTGGACGTCCTCCATTCTTGTGAAACAGCATCTCCTCCTTATGCAGTCGGTCCATCTTGTCCA
GATACACGGTCGCAGCATGGCACACCTTCCTCAACTCACTGCTGTCCAGCTGCTCGGCCACTCGCTCCTCTCGACGCAGGATCCTCCTCGCGCGCTTGAA
CTTGCCCAGCTGCAGGGCGTTGTACATCAAGTTCACTCTGCACTTGCTCTCCAGCACGGGGTCCTGGAGCCCCATGGAGATGCCGATCTGCAGCTTGGCC
AGCAGCGTCGACTGGTTCAAATGGCGACACAGGAAGTGGCCGCCTCCTAGCGTCGAAATGTACGCGTTGGCCGTGACCAGCGCCACCACCGCATTGACCA
GCTTGACGGCGCGCCTCGCTGATGCCATGTACAATGGCAGGAGCTGCGTGGGTCTGTACGTAACCAGCACCAGCACTCGACGAGTGTCTTGAGGGCTCTC
CGCCACGAGGTAGCGAGCGGTGGCGTCCTCCCAGTGGATAATGTTCTTCTGGTTGGTCTTCAAACTGATTCTCTCCACCAACAGCCTCGAAAGCTGCTGT
GTCTCCTCCGGATACATGCAGAGCCCTCATCCGATAGTAGAAAGGTCACAAACTGGAAAACCTCCGCGTCTGCGATGGCTACAGAGCCGCAACACACGGA
AATTATATGGGGAGAAGTGCAACATTTGTGTGTGAAGCCACGGTACGTTTCAATGCGCGCAAGGCTCTGCGCTCCTGCAGCGGCGCCTCGAAGGCCACGA
CGCTCAGGCGGACACCCAGTGCAACACCCGTCATCTTCCGAAATGGATGCATGTGATCGGATTGGATGTAAAGAAGTTCATTAATAGCCAATCGGAGACA
GATGCATCTTGAAGCGACGCGTGCGTTTGGCTCGGATATCCTCATCGGCCATGTCGCTCTTCCAGGTGCGCGAGTGGTGGGCCGCCAAGGGCGAGAATGA
CGAGGAGTATACTTCAGGGGCGCTGGTCGTGGGCAACGTGGACAACGACGCGTCTGGCCATGGTAAAGTGCGAATTGTTGCAACTGTGGGGGGTCTCGTC
CGCTGACTGCGACACACATTCCTACAGCGAAGATCGTGACGGGCAGTTTGAACGGCGTGTTGCGCGTATATTGCCCCACGCAGAGCGACTTCCGCATCGA
GCATTTGCTGCTCGAAGAGAACCTCCGCCGCCCGATTCTGCAGTTGGCGCTGGGCTACTTTATCCCGTGAGTCTGGTGGCCTCACGTGCAGTGGATGAAA
CAGTATAGCTGATTTTGTGTTCTGTACGGCAGGAACCAACGCATCTTGGCGCTGGCCATTCTACAGCCGAGGAGGATTGGGGTCTATGTGGTGGAAGGCA
TGGGCGGGACGGGGATGGCGGCGAGTTACTTCAAGATCACACTACGATACGAACACCTGTTGGGGATCGATGGCGAGCATTTTACAGCGTACAACTTCAT
TTACGGGCCGTTTGGGTCAGCCAGCTCGAGCTCTGGCGGAGCAGCTCCTGCACGCTTGGAGAAAGATCATTTGTGCGTGCAGTCGCTGGATGGGCGGCTT
CAGTTTTTCGAGCAGGACCGATTCGCATTCCTGCAGCCACTCAACAACAATTTCTTGCCGGGCGCGATATGCTATGCGGCTGGCATGGACGCAGTTATAG
CAGCCACGTCAGACTTGCAACTTGAGTGCTACCGTTACCAAGTCTTGGCCTCCGCCTCGCTAAAGAAGAAGAAGAACGCGCTGGATGAAGACGGTAAAGA
AGACCGACAAGGGGATGCCTCGTCGGCGTCCGTACACTGCGATTGGAAGATTAATATTGGTGAAATCATTGTGGATGTTCGAGTGGCGCGAACTTCATAC
CAGGACTCGGCAACCAGCTTTGACATTCTGGTTCTTGGAGAATTCACGCTTTTTGGTATCAAACCCCAAGGAGAGGTATATCTGCAGAAGCGACTAGGCT
TTCACCCATCGGCATTTTGTCCGTTCCAGCGCTGGGCATCACCTACCGAGCGGGGTACACCAAACACCACTGCGCTGGAAAACCTGCTCGTTGCCAGCGA
TACGAAACTGTGGAGTGTCTTCAAGGACAAAACACTCATTTGGTCTGCTTGTTCCTCGGTGGTTCCCGTGGCCCTCCAGGTCCGAATTTGGCGGCATAGA
TGGAATGATCGTGAGCCTCGACTCGGATGGAGCGCTTTCTGTGAATTATATGGGTACAGATCCGCCGTCCTCCGCTGTTGTTGCACCAGACACAAAGGAA
ATCAACTATGAAGAGATGGATGAGGAACACCCACAGCTACTGAATGTCATTCGACGTGCACAAGGCGAGCGACGGACGGAGCCAAAGGATCGTGTGTTGA
TCCGAGCCCAGGTGCCTGCAATACTGGATGCACTACCGGATCGGAGCGACGAGTTTAGTCGTGGAGGCGGGAGCCCCGTACATGATGGCAAGAATACACA
GCTGACGATGCGCGTGTACGTCACGTACACGGGTGCCAACCGTGTGTCCAATGTGACGCTATCGGTGTTGACTCCCGAAAATGTGGCGGCTAGTGACTCC
TCCTTCGTGATCGGGAGTATCGATGGCAAGGCATCTACGCCGCTCATCATTCCGGTTGTATTGCGCCCAAGTGCTGAAGCAATGCCAACCTCGTTATCCG
TTACCATTTCAGCATCCTACACACTCGAGACAGGGCAGCCTCGTGTCTCTCAGTGTGTTGTGAAGTTGCCCATGTGCATGGCGTGCCGCCTCGTGCCTCC
CGTCAAGTCGAGCACCTTTAAATTCACCCTCGAGACTAATCAAGAGCCGCTGGAACTTGCTAGCCTGTTCGAAGACATGCTTCACCAGCCAAGTTGCACG
CCTGAGTGGGCAAAACAAGTGGTGGCGGGAGGATCCGGTACAAACGTGCTGAGCTTCCAGTACTACAATGGTGTCGAAGCCACGATTCTCGTGTCGAAGA
ACGCTGGACGGTACCGCATCCAGTCGAACGAGCTCGAGGCGCTCTGGATGGTGTCACAAGAGCTCGTTGTACGACTCCGTGCATACTTTGACGGTCGGGA
GCAGAATGCGGAGGCCAAGAGCGGCGGAGGTGGATCCTCCTCGTCGGTGTTGGAGGTGTTTTACCAGGAGCCCCTCCCGCTCGCAGATTTCTTCGGCGCG
ATTGACGCGCACTTTGCTCTGCGAAAGGAAAAACTTGAGCTCGCGGCGCAGCTGAACGACCGAGCCCACCAGTTCCGCGTCATCCAGAAGCGGTTGTTGG
TGCGCTACAAGGATCGCAGCCCCGCCGCTGTGAATTATCTGGACGTGCTGCTGCACGGCACGTATGACCAACTCATTTCGTTGTCGCACGCCATGGAGGC
TGTGGAAGTCAAGCTCAAGCGCGCGGCGAACCGATTGTCGTGCTGCGTGTCGCTCATACTGATGCTCATTCAATTCCGGTTCCACCTGAGCGATGAAGAC
GCGCAGCTGCTCGAGGCATATCTGTCGCCCGTCGTGAACGAGTCTGCCGACAGCGGTGCCGTGGAGCAAGGCTGGGAGGAGCGGACCGACTGTGCCATGA
CGGAGCTGCTGCGCACAGTGCTGGCCAAGCAGCCCCAGAACAAGGACGGCGCGTCTGCGACTCCTGCGCTCGCGACGAGCGAGCTGCAGATGCAGGAGGA
CACCAAGCGGCTGAAGAAGCACATTACAATCGTGTGCGACCGTCTCGGCAAGGGCGCGTCTCTGGTCTCTGGCAGCAACACACCGCTCCCGGCAGCGCAG
CACCACCTCCCGGCGAATCGAAGGGAGACTAGCGACAGAAAATGCTCGCACAACATCATTTAGCTTTCGTCGTGTGGAGACTGCATCCTAAAACTTGAGG
ACGATTTCAATTTGACTTGCCAGTTGTATTGGTCAAGTTGAAGTGGTCGTGATTGCCAATATCATCTCGGATTGGTAGAAACAGATAGAAATCAGATGCT
GTAAATTCTTCCATTGGCTGAAATGACTGCGTAGAGTGTGTACTTTTCGTAACTGCCGTCTGCTCCAAACATCCTCGATGATCTGATGCTCTGCCTTCTT
CCAGCCTCACCTTCTTGTCTCTCTCTTGCAATGATTGCCATCAGTTGCTCGTCTGCCTCACTTGCAACTTTCCTGTCATTGACGCAATTCAAGAGACCAA
GATGAAGGTGGCACTGCAACTGCTCGCGAGCTTCGCGGCGCTGGTGGCCGTGACTTCAGGCGCCCGCAACGACGACGCACTGGTCAAGAATCTGCCGGGT
TTGACCCGAAAGCTGCCGTTCAAGCATTACGCCGGCCACTGGAGCTCGAGGAGAAGGAGAAGCTCTTTTACTGGTACACGGAGAGTCAGAACGACCCGGA
GAACGACCCGATCGTGCTGTGGCTCAACGGCGGCCCGGGCTGCTCGTCGCTCGGCGGCCTCTTCACGGAGAACGGCCCGTTCGTCGTGCGCGACGACCTC
TCCATCAAGGTGAACCGCTACTCGTGGAACCGCAAGGTAAACATGGTGTGGCTCGAGTCTCCCGCAGGTGTGGGCTTCAGCGGACCAGTGGAGGGTCCCA
ACTACTACAATGATGACGTCGTGGCGGCCAAGACGCGCGAGTTCCTCGCCCTTTTCTTCAGAAAATTCAGTGAGCTCAAGAACCGCGACTTTTACATCAC
GGGTGAAAGTTACGCTGGCATGTACATTCCGTACCTGGTGGATCGCCTGGTGGAGGAGCCGATCGAAGGTGTCAACCTCAAGGGCTTCGCA