Description :
From Genome Similarity Track
Location :
contig_71:152638- 157665
Transcript NameFunction/comments
g9662.t1hypothetical protein

Sequence
5027 bases(100 bases per row)
CACAGGTCATTTTACTAAGAATCAACAAAGTCTTTCCATCTCGATCTGTAACCACGTATGGTCCATATACTAATACAATTAATTCTCACAGGACAACGAC
CTGCTTCAGAAATATGCAGCAACTTCAACTATTGCGTCGCGCGGTCTCCGTTGACGGCAGCCATTCCTTCATTTCCCTCGCCCCAAGGAAGACATTTGCA
CTACAGGAAGCAGCAAAACACCCCTATGACAGGTCTATCCGACACTGTAAACTCGGATGAAAATCCTCCGCTGGCGGAGCTGCGCAGACTCAAGTCGCAA
GCGCAAAGTGGCGAACGTCGTCGCCAACTTCGACGCGAAGCCCAGAAGATCGAGAGCAAAAAGCCCAACCCATCGGACCCCGAGCCACAAGAAGCAGAGA
TGGACGAAGCCGCAACGCAAGAAGAAGCGCAACTTTTTCAAGTGGCTGCTCACGCCGTCTGTGGCGACCAACCGCCAAGTGGCTCCTCCGAGAGTTCGCG
TCAAGATCCCCATCGTGTATCGCAACGGCGAGCACAAAGGCGTCGTGGTGGGTGGAGTGCGGGTGCCATTCTCGCGGCCAATGCAGGCGAACCGCCGACG
TTTGTTGCTGTCTCGAGACGACGTGAGCTCCGTCATTCCAGAGGACACGGAGTTCGTGCTGGAGTTCCCGCCCAGACTTGCTCGCGAGGAATTCGAGACG
GAACACAAGCGCAAAGAGCAAGAGAAGAACAAGTTGAAATACGAGAAACTGGCAAAAGAACTGGCCAAGTAAGTGGTCGGCACTGCCTGTCGCCGTGTTC
ATTCAGAAATCACCACCAAAGTCTCCACCATCGAAGCCACCACCACCATCGAGGCCATCACCACCATCGAGGCCATCACCACCGTCGCCAAAGCCGCCTC
CATCGCCGTGGTCAGCTAACGTCTCTCCGAGTAAAAATCCACCGAGAAGACCAGCAGCTCCGCCCAACGCAGCCCCAGTGCCGGCCCCCATACCACTCCC
TCCATTTCGACCGTAGTACCGACCGTATGCAGGGGTAGCAGCACTCGCAAACGGAGCTGTAGTCCCGTATGGCTGATCGGAGCTTCCTCCCGGTATTGGA
CTGGAGACGGGAGCTGCCATGGGGATCGCACTATCCGCCGTGCTCTTTAGCCCGTCTAACAGCATGAAACAACAGCCACCGCAGCACAAGACCAACGCTA
GAGCTCCCAAGAACCACCACAACCAAAGTAGACCACCGCCATCTCCGTCACCTGCGCGGTACGGGGCATACCCGCAGTTGCAGGCGTAATTGGAGACCTT
GCAGACGGCGTCATCGGGGCAGCAGCAAGGTCGTCGTTCGTTCTGGCGGTCCAGCCAGTTGCCACAAAATTGGCCATGCGTACCGTGGTAGGCCCGAGAG
CAGTCCCAGTGCTGGCACACACGTCGCAACCTGACTGCGTGCCGTTGGTTGGCCCGAGGCTGCGTGGATCACCGCAGCGAGCGTTAACAGCCTCCAGAGC
TCGATCATCGCGATCTCTTGTTACCGCAGTAACTATCGCTTCTGATCACTTTCGCAGACAAGAACTTCCTGTCTCACAAAGCGGGACAATTACAGACTAC
AACCATGATTAGAAGGTAGACAGATTGGACCAGACTTGATCTACACTACTGTGATTAATAGATTAACTTTTGTTGTAAACTGGAATATGACGTTTCCTGC
GGTGTTTGGTTATCTACATCGTGAAAGGATTATTTAAAGCGTCGCGACGCCTCGGATACAAGAGCTCCCGCAGATTTCAATGGCACCGCTCAAGATCCTA
ATCGTTGGGCCCAAGGAGGCTGGCAAGTCCACCGTGCGTCGATGCAGTAAGCTGCAATGCACTCGCTGTGACGTTGCACTCACCGCTTTGTATCTTTGCG
CTCTATTCTTCAGATCGCCAACTTCCTCGCAGAACACTCGGATCGACTCGGCGGTCAGGAACGATACCAACCCACTATGGGGTGCGGATTCTCGAGCTGG
AGAAAGGCAAGGCGACCGTCGAGCTTTGGGATGTATCAGGCGACCAGAAGTACGCCTCCTCCACATCCTATTACTGCTTGCCTTGGTCTCACTCGCAACA
TTATTCATTCTGCAGCTACGAAGCTTGTTGGCCAGCTATCATGAAGGATACAGACGGCGTCATCCTCGTTTACAACCCGGAGTCTCACGTTCACGAGAGC
GAGGCGATGCTTTGGTTCGTGGTCGCCACCAGTGTCAAGTATTTTCAATTGCTCGAACTAACACTGTTGAACGATTAGGTACGAATGGTTCATGCAAAGT
GCCGGCTTGGACAGCTCTCAGTGCCTTATCTTCGAGCACTCGACGGGTAGCAACAACGCTGCAATTCCGATAGCGTCAAAATCGCGTTTGCCAAGTCATT
TGCGTGTCGTCGCAACTACATTCGACACGCCCAACGTCTTCAAAAGCGAGTTTAGCCGACTCGTAGCCGCTGCACTCGTGCGCCAGCAGCGTACGGGAAA
TCGCAAGTGAAGCGGCCATCTTTGAGATGTAGCACGACAATCGTACGTTAGCGAAGAATCGTCACGAAAATGCTGTTTTCATGAGGTACATTGGTGTCAC
TTAGGCTTTCGTTACGACGTCCTACATGTAGCTATCATCCTCAGGCATGCATGAAAGGTAATAGGGACGCCGAAGACCGTTTTGAGGACGACGGCATGCT
CCAGCGACCAGTAGTTTGGAATTGAGCCATTACGGCGATGGGTGGGACAAAATAGTGTGCTCTCGTGTGTTCCCGAGCCTAAGTGTGGTGCTGTCTTTTG
GGCTGGAACTGACAAACGTTAAGTACTCGCTGCAACAGAGGTGCATGGCCTATTGGGGTTGTTTGCAAGACACTCAGCTATCGATAACTGACGGCGCGTC
ACTCGCCATGATGTTAGTCTACAATCTCCTTCTTTGTTCTGATGCGCGTATTGCGTCAAATGGACACATATTGTGGCCATACTTTGAGGGTTAACATGTC
TTTGACCTACATTTCCTGCCCTCATAATACAATACGTTAACGCACTTGACAGCCTCGTTGCACTGCCTGAATGCTCAGTGTCTGAGCAGCGACGATTGAG
CTATGTGGTAAAAATTTGCCGCAAAATGCTTGCGCGTGGATCCGAGACCAACCTGCTTCGGCAACGAAGTCCGCAAAGATCGCAAGGAGTCAGGCTTATT
AAGGGGTATGAAAAGAGATTGTCTCTCTGTTCTATTGAACCAAATGCTGACTACAATGACGCCCCCCACACCTTTTAAGCCACCGAGCTTCCACGGGGTG
ACAAAATCATCCGGAACGTATCGGTCGCCGGTCGCAGTCGCGTACATGCCAGCAACGGCGCAACATCTTGACAAATGCTTTAGGCGACAGTCTCTATCGA
GTCCCAACGTCCAACCAGTCTGCATCGCAACCAAATTGCGAAAAATAAGACCCGCTGTTCCTCATCGTGTAGAGTGCCATTCCGAGACTTACCCCCCACG
CATGCTTTGGCCAAGGATCACGTGACGGGCGGAACCTTGCAGTGCTCATTTTTGCGCCGCAAAAGTCTTCAATGCTGGCACTATGCGACTGAACCACGAG
CACCCCAAGCGAAACCCATTGAATCAAGAAACACCTTATTGAGTCGACTGCTTTACGTAGGAGTGGCCGCTACGAATCCTGTTGACAGTGTTACGGAGAG
CTAGTCCCCACACTTCCTCCGGCCATGGGAGGTAAATCGTAGCGATCCTTTTGCCTCCGTTTACAAAGAATTGTTCTGTGCAATTACTATGTAGCCGAGA
TCGCGATGAGAGCAGAGTTCACAACATTCATTCAGACTATTGGGTGGCAAGGACTACAGTTGAACCAACCAGAAGATGCGATCCACCAGTTCACGAGATG
TTTGCGATTGCGTTTCGATTCGGGATAGCATCATCGCTACTTGTACATGTAATCGCACTTCATGTGACACTCAAAGGGGCTAGCCAAATGGCGCGTTGAA
GTGCCTTATGCCGCAATCTTCCTTGAGAGGCGTAAGTCTACAGCTTCAACCCGTTGATACACTCAGTCATTCTCAATCTTCCCTCTGACCGCGCACATGA
GCCCCCCACCAACCATGAAGAACGCTGTTTACCGATTCGGTGTCGCACTTCCTACAAGACCATCAAGCAAACCACGGAGCCGTTCCAGCCGTGCGAGACC
ACGAGGTGCTCGTGGAAATTCACGGCGTGACGCTGAACTACCGCGACCTCGCAATTTCCAAGTCCGAGTACCCAGCACCGTGACGGAGCATGTGGTGCCA
TGTTCCGATGGTGCCGGGGTCGTGGTCTCCGTTGGCTCTGCGGTCGAAGACATCGACGTGGGTGACCGAGTCATCACCAACTTCGACGTCACTAATCTCT
ACGGCCCTGTGCTCAACGGAGGCTCGCACCGACTGGGTGGCGTGCTGGATGGCATGTTGCGGCAATACGCAGCAGTCCCAGCTCAAGCAGTGATTAAAAT
TCCGGAAGAGTGCACACTGGACTTCGTGCAGCTTGCGTCGTTGGTGTGTGCTGGTGTGACGGCTTGGAACGCGTTGTACGGCCTTGCTCCGCTGCGTCCA
GGACAAGTTGTGCTTCTTCAAGGCACGGGTGGCGTCTCCATCTTCGGTCTGCAGCTCGCCAAAGCTGCGGGCGCCGTCACGATCATCACTTCCTCTTCAG
ACGAGAAACTCAAGTTTGTCAAGGAGAAATTTGGCGCCAGCTACACCATCAACTACCGCACGACGCCGGATTGGGCCGCCGAGGCGAAGCGCATCACGAA
TGGCAAAGGTGTTGACTTTGTTGTTGAGAACGGTGGCTCCGGAACAATTGCCCAGAGCATTGACGCGGTGGCCCCAGGGGTCAGATTGGCTTGATCGGCT
TCTTGGCCCGTGCAACCCAAGAGAACATGCCGGATGTCGCGGGGCTCGTCCTGGGCAAGGGCTGCATCATCCGCGGCGTGCAGATTGGCAGCAAGCAGCT
CATGGAAGACCTTGTCCGTGTCGTGGT