Description :
From Genome Similarity Track
Location :
Scaffold_1891:1526- 4140
Sequence
2614 bases(100 bases per row)
AAGTGGTTCAGAATTCGATCATCGATATACTAATCCATAGTGCTTGGTGTTGTGCACGTATCGTAAAATATTTTTCACAGCAATCCAGTGAAATCGAGAA
GGGTTGGAAGCTTGACCGGCTACTTGGTTGACGGCAAACGAAATATCTGGGCGGGTCACTCTTGCTAAATAAAGTAATACTCCGCCTGCCTGTCGAAAGG
GAGCGTCTCTGGTTgattcatcttcttctgtttTGCTGTAAAGCATACATCCTCTATCCATGGGCGTCTTTCTTGGTCTACAATCATCCATTCCGAATCG
CCGAACAATTTCTGCAGCGAAACTTGATTGATCCAACGTCGTAGTTCCGTGATCACGATCGACATGAATTCGAATTCCTAGAAACCAATTGATTTCGCCC
AGATCTTTCACATCATACTTAGACTTGAGGGAATTCATGATCTTGATCAAATTCTCTTCACACTGATAGCCTATCAGGATATCATCAACATACAGAAGAA
CAATCAGTTCAGAAGTAGGATCAGTATACACACAGGGATTTTCCCGAGTAGGTTGCAAACCACATGAGACGAGGAACGCATTAACTTCAGCATTCCATTC
GCGTCCGGCCTGCTTCAAGCCGTATAACGCCTTTTTAAGTCTCCACACTAGTGCAAGACTGCCCTCCTCAAACCCGATAGGCTGACGAACGTATACCGTT
TCtttcagcttctccttgacATACGCCGTAGGAACATCGCCCTGGCGCACTAGCATTCCGTTTTGGGTTGCAATTGCTAGGAAGACGCGGATTGAGTTCA
GACGGGCCACGGGAGCGTAGGTTTCAAAATAATCTTTTAGAAATTCTTGGGAGAAACCTTGAGCGCAAATCCGTGCCTTGAATTTATCAAGTTTCCCGTT
GGCATTCAGCTTTACTCGAAATGCGATTGTGGTACCGATTACGTTAGCATTACGAGGTAATTCGACCAAATCGAATGTGTCGCTGTCTCGAAGAGCTTGG
ATCTCATCCCGAATTGCTTTCTCCCACATCGGCCAATGTTTTGACAACTGGGTTTCTCGTAAGTTGTGCGGAGCTTCGATAATGTCATGTACGGTAGCAC
TTGCAGCTACGGTGCGGGCAGCACGATCTTGAATACGCTTTGAACGTCGAAGTGGGTGGGTTGTGATGGAAGATTTGTCCGACTTTGAAATGCGTGAAGC
TGGTCTAATGCTCATGTTTCATCTCGTACCCGAAACTGTCTCGTTAGACGAATtgagttgctgaagctgcgagGTTCCTTCCAGTTCATCGTCTGAGTCT
TCCTTTTGGACGAGTTGTAGAGGATCTTCCCCGTCTTCGGCGCGTTTAGAATATTCTTGTGGTGGCTCCAAGAACACTACACTTCGACTGTGGACAACCC
GATGCTGACGGCCAGTAACGTAGACGAAATAGCCTTTGCGATGGGGATCGCTTCCGATAAAAATCCCAGCTCGTCCTTTTGGTCGAAATTGATATGCAGT
TGACCTCTGATCTTTCGGAACCAGGACAACACAATGTTGACCAAATGTCTTGATGCTTTTCATATCTGGTTTCCGACCCCAAAACTTTTCAAAAGGTGTC
ATCGTTGGATCCCCTTTTGAGAGGACACGATTTCGAGAGTACACAACACTACGCACGGCATACTCCCACAGATAGTGTGGAATTCCAGCTTGTAGCATTA
ATGCTCTTGCTCCATCTGCTAAAGTGCGATGAGTACGCTCAATTACTCCATTTTGATAATGAACTTCAGGTTCCGACATTTCCAAATAgatttcttcatc
gtcacaAACTTGTCGAAATTCACGTCCTATGAACTCTCCACCATTGTCAGATCGGAAAATTTTTATaatcttgatcttcttgcccgAGTCGCTGAATCGG
CGATTAACTAAGTTCAAGTAGACACGAAaacttgcagcagcgtcgctTTTGTTCTTGATAAAGTAGACTGAGGTGTGTCCCATCCACTTTAGAGCCAAAT
AGTAGTGGTTGCCGTTATAACTACGCTGGAAAGGGCCAGCAAGATCTCCGTGGCATACTTCATCTTGTGCTTCCTCTGAACGTGTGGCTTTCTTGGGCGT
TTTCGTTCATTTGCAACCATGATGCCAATCTGTTGTTTAGGCAGTTTGGTGCCAAACTCGTGAAGTAAATGTTGTCCTAGACTGTCCAATGAACGTGGGC
GCAGTTCTTCTAGGTTCGCAATATACCAATCGCTGGCCACACCTCGAAGATGTTGAAAAAGTAGAACGTTCTTCATTCGTTCAGGCAGCCGAACATTGTA
CAAGTCTTCCTGCATTCCAAGCAGTGCCTTGAAGCGTTGAAGCCATTTAGCGGCGCCTGAATCAATGGCTCCTGGTTCTGCAGGACCATCGAAAGTGTCG
ATCTTGAACGTCTTCACGATGCATTCGTATGGCGGTACCTCAGGTGCAGTATGCCGATTGGGTGCTTCCGTCTCGGCTCCTTGGTATCCGTACCGTTGAT
AAATAGGGCACGGCTGTTGTCGAACTTACTGGTTGAACCACTGCTGTGGTGAGAACAGTCGCGAAGGGTCTGGTGATTGATTCCTTGTCCCCACGTGATC
TCTAATGCGAGCAT