Description :
From Genome Similarity Track
Location :
Scaffold_2:152595- 156210
Transcript NameFunction/comments
Phyci_111395unnamed protein product
Phyci_127652lysosomal beta glucosidase, putative

Sequence
3615 bases(100 bases per row)
TAGCAATTTGACTTTATTACGACGAGATGTTGGCTGGGAAGACCCCTCCCCAGACACGACCTACGTACGATAGCACGCTTGCTCCCCCCGTTGGACGACA
CGCCCACTGCAGTGCGCGCGTTCCTAAATGCAAACTACCGACAGGAAAAAAGCGATCGCGAGACCGCGGACGCTACCAACGCCTCCCAGGTCGCTTATCC
AGGAGGAAGACGCGAAACGTCAACCTCTACGTCGTCAGCCTCGTCCAGAAGCGTGCGCGTGGCGCCCTCGAACGTCGAGAGGTCGCCCAGCTTGTCGGTC
ACGCTGGTGCTGCGCGCCATGGCGATGACACCGCTGCGGTGGATCTCCGTGATGCCCAGGGGCTTCAGCAGGTCCAGGAAGGCCTCAATACGGCCAGGGG
TGCCGGCCAGCTGCACCATGACCTGGTGCGGTCGCACGTCAATGACCTTGGCGTCGAACAGGTTGGCAAGCTCCACCACCTCAGCGCGAGATCCAGCCTC
TGCATGTAGCAGCAACACACACGGCCAACGTTAGCCCCTGCACTAGATTCCGGGGGTAAGGTAGCATTATCAGCAGTGAGGGCGTACCGGCAGTAGACAC
CTTAGCCAGCATCAGGTCGCGCTCGACGTAGTTCTTTTCGGCGTTCTTGCCGCTGCTCAAGATGTTGACCACAGCCACGTACACGACGTCCTCCAGCTGC
TTCTTCATCTGCACCACCACAAAGTCCGTACCAGGAGTAGTTAGTCTCTTGCCTCCCCTCCCTAAAGCTCTTTTTCGACTTTCCGTACGTTGACAACGCT
CTGGGCAGTGCCGTTGACGACCACCGTCATGCGAGAGAGCTCCTCGACCTCCGTGCGGCCCACCACGAGGCTGTCAATGTTGTACCCTGCATCAAACAGA
CACCCACGCCCAGCTCAGTCCCTGTCGTCTTCACTTTGCGGAGCGGATCCTAGAGAAGCCTCGCGTATCTATCTACCTCGGGCGGCGAAGAGATTGGCGA
TCTCGGCCAGACAGCCGGGCTGGTTGACCACGAGCGCGGCGATCACGTGGCGCTGGCTCTGCTCCGCCACGCTCAGCGAGCGCGAGAAGAACTTGGGGGC
GGCGCAGGAAGGCGCGATGGCGGCCGCAGACCGCGGGAACGCGCGGCGCGCCAGGGGCAGCACAGACCTCCTCAGCATCTCGGCGAATGTCGAAGTGTGG
CGTCTGAAGCTCGTGGTCCCAGTTCTACGTCGCGTTTTGGAAAACGGCGTGTCTGCGCAAACAGTGGACAAGTTCGAAGCGGCCACGGTACCTCCCTCCG
CACCGGAAAAGTACCGGATCTCTCGATTTCAAAATCACAGCTATTACGGTAAACTTCAAAATGCGCAAACACGCTGTTCACAAGAAAATGATCGTGGCGC
TGGCCTGGACGCTGCTCGCCTGGGCGTGCAGTGGCGCATCGGAGGCTTATCTTGCGGCGGCCGCGGCTCCAGCTCGTCATGAACTCGTGTACGAACCCGA
CACCGCCGTTTTTGCCGAGCTAAGGGGCCCAGTAGAGCCCTTGAGCGACTCGGATGGCTTGGATATCGACGCCCTGCTCGCCAACATGACGATCCGTCAG
AAGGCAGCGCAAATGACGCAGATGGACATCTATTCCATGATGGACGGCGACGAGAGAGACCCGAAGAAGGCTCTGAGGCGCGAGGTGGTGGCTCGGTACG
CCCGCGCAGGCGTAGGCTCCATCCTCAACAGTCCATTCGCGGGGGGACCCGTGGGCGGACGCACcggctggagcgccagcgagtggagaacggtgataca
gcagatccaccagatctacaaggaggagggggcggcagtgcccatgctctacggggtggacaccatccatggcgccacatacgtgcagggcgcgacgctc
tttggccagcccatcagtgctgcagcctcgttcaaccccgagttggtgcaccgcatgggtgccgtggctgcgaaagacacactgagcgcgggcatcccgt
ggattttcagtcctgtactgggcattgcagtgcagcccaagtggtctcgagtgtacgagacgtttggcgaagacccactggtgtcgtccgtcatgggagc
gacgcttatcaaaggcctgcagagttcgggcaaggtggcggcctgcatgaagcactttattgggtactccaacgtccgtgaggggctggaccgcgcggac
aacgccattaccgactgggaacttgtcaactactacgcgccgtcgttcctcgctgcagtccaagctggcgtgcgcaccgctatggagagttatgtgtcgg
tgaacggtgtccctgtgattgccagcaaaaaactacttgttgatttattgcgacaggatatgaacttcacaggtctgctggtctcggactacagcgaagt
tgaccGCATGTACTCGGAACACCATTTAGTACCGAGCGTGGCGGATGCCGTTCGCGTCACCCTGCAAGAAACGTCTCTCGACATGAACATGTCACCTGAC
TTGCAGGCCTTTGGCGATACGATCGAGTCGCTAGTTGCACATGGGCTTCTGTCAGAGACCCGTCTTGACGAGTCTGTTCGGCGCATTTTGAAGACGAAGC
GCGATCTGGGCCTACTCGACTCGAGCTACTATGACGACTTTGCCCAGGATGGTATGGACATTGACGAAGGCGTCGGCATCTCAGCCGACCAAGAGGACGC
TCTGAAGCTGGCCCAGGAGTCCGTCATCTTGCTTGAGAATCGCAACGCTGCACTTCCCATTGATCTGGAAAAGACCACCAGCGTGTTTGTCACCGGCCCC
GTGTCAGACAACAAAGGCTTTCAATGCGGTGGGTGGTCCGTCTTCTGGCAAGGATCCAGCGATTCGGCTCTCTTCCCGAACGGAGCCACGTTCAAGGAAG
CAGTGCAGGCGAAAGCAGCCGGGCGCGCGCAGGTTGAGCACTTGGAAGTGGTCAGCATCGATGGCACGGTAAACCCGCAAGATTTCCAGCGCGGGATGCA
GCTTGCTACCAAGAGCGACTACACCATTGTCGTGCTAGGTGAGCGCAACTACGCCGAGAAAACTGGTGATCTGCTTGGCAGTATGGCGCTACCCGCCGGA
CAGTTGTGGTACCTCCAAGAGCTCTCACGGCTCAACTCTACAAAGGTGATCGTCGTGCTGGTCTCAGGGCGTcctcgtttgctggagggagcgcacgatc
acgccgacgcggtcattctaagcatgctgccctgcgagcaaggcggtcaggcgctagcagacgtgattttcggcgacgtgaacccgtcagcgcggctgcc
aattacctatcctgcccgcggcacgcagctactgccgtactttcaccgggtcaacacccgctgccagccgtacgatgagtgtccggttcagtgggagttc
ggccacggtctcagttacagcaggttcgagtactcggcgcttcggctcaacaccacgcaggtgcatgcaacgtcgggagcgttggaggtcggcgtcaccg
tgacgaaccgcggcactcgcccgggcaaggaggccgtgctgctgtttgtggcgcagaagttccgtcgggcgtcggtgcccgagacgaggatgctcaaggc
gttcaagaagctgga