Description :
From Genome Similarity Track
Location :
contig_12:152588- 155589
Transcript NameFunction/comments
g3155.t1hypothetical protein
g3156.t1hypothetical protein

Sequence
3001 bases(100 bases per row)
GACTGGACTATCGACGAGCTTACGGCCGGCAAGATCACATGCTTAACAGCCAGAAGAAGTCTGCTCAGAGATGAAACAAACCTTCAACTTGTTTAACGTT
TAATGAACTGTATCAAAGGTGTAGTAAACTCAGAAGCTAATTTGCTGGCATGTCGATCTTCTCACTTGGTCATTCGGACGATCCTCTGCCGGTAGAAGTT
GTCATGCAACGTGGCTGGACGTCCTCCATTCTTGTGAAACAGCATCTCCTCCTTATGCAGTCGGTCCATCTTGTCCAGATACACGGTCGCAGCATGGCAC
ACCTTCCTCAACTCACTGCTGTCCAGCTGCTCGGCCACTCGCTCCTCTCGACGCAGGATCCTCCTCGCGCGCTTGAACTTGCCCAGCTGCAGGGCGTTGT
ACATCAAGTTCACTCTGCACTTGCTCTCCAGCACGGGGTCCTGGAGCCCCATGGAGATGCCGATCTGCAGCTTGGCCAGCAGCGTCGACTGGTTCAAATG
GCGACACAGGAAGTGGCCGCCTCCTAGCGTCGAAATGTACGCGTTGGCCGTGACCAGCGCCACCACCGCATTGACCAGCTTGACGGCGCGCCTCGCTGAT
GCCATGTACAATGGCAGGAGCTGCGTGGGTCTGTACGTAACCAGCACCAGCACTCGACGAGTGTCTTGAGGGCTCTCCGCCACGAGGTAGCGAGCGGTGG
CGTCCTCCATAATGTTCTTCTGGTTGGTCTTCAAACTGATTCTCTCCAACAGCCTCGAAAGCTGCTGTGTCTCCTCCGGATACATGCAGAGCCCTCATCC
GATAGTAGAAAGGTCACAAACTGGAAAACCTCCGCGTCTGCGATGGCTACAGAGCCGCAACACACGGAAATTATGGGAGAAGTGCAACATTTGTGTGTGA
AGCCACGGTACGTTTCAATGCGCGCAAGGCTCTGCGCTCCTGCAGCGGCGCCTCGAAGGCCACGACGCTCAGGACACCCAGTGCAACACCCGTCATCTTC
CGAAATGGATGCATGTGATCGGATTGGATGTAAAGAAGTTCATTAATAGCCAATCGGAGACAGATGCATCTTGAAGCGAGCGTTTGGCTCGGATATCCTC
ATCGGCCATGTCGCTCTTCCAGGTGCGCGAGTGGTGGGCCGCCAAGGGCGAGAATGACGAGGAGTATACTTCAGGGGCGCTGGTCGTGGGCAACGTGGAC
AACGACGCGTCTGGCCATGGTAAAGTGCGAATTGTTGCAACTGTGGGGGTCTCGTCCGCTGACTGCGACACACATTCCTACAGCGAAGATCGTGACGGGC
AGTTTGAACGGCGTGTGCGCGTATATTGCCCCACGCAGAGCGACTTCCGCATCGAGCATTTTGCTCGAAGAGAACCTCCGCCGCCCGATTCTGCAGTTGG
CGCTGGGCTACTTTATCCCGTGAGTCTGGTGGCCTCACGTGCAGTGGATGAAACAGTATAGCTGATTTTGTGTTCTGTACGGCAGGAACCAACGCATCTT
GGCGCTGGCCATTCTACAGCCGAGGAGGATTGGGGTCTATGTGGTGGAAGGCATGGGCGGGACGGGGATGGCGGCGAGTTACTTCAAGATCACACTACGA
TACGAACACCTGTTGGGGATCGATGGCGAGCATTTTACAGCGTACAACTTCATTTACGGGCCGTTTGGGTCAGCCAGCTCGAGCTCTGGCGGAGCAGCTC
CTGCACGCTTGGAGAAAGATCATTTGTGCGTGCAGTCGCTGGATGGGCGGCTTCAGTTTTTCGAGCAGGACCGATTCGCATTCCTGCAGCCACTCAACAA
CAATTTCTTGCCGGGCGCGATATGCTATGCGGCTGGCATGGACGCAGTTATAGCAGCCACGTCAGACTTGCAACTTGAGTGCTACCGTTACCAAGTCTTG
GCCTCTGCCTCGCTAAAGAAGAAGAAGAACGCGCTGGATAAAGAAGACCGACAAGGGGATGCCTCGTCGGCGTCCGTACACTGCGATTGGAAGATTAATA
TTGGTGAAATCATTGTGGATGTTCGAGTGCGCGAACTTCATACCAGGACTCGGCAACCAGCTTTGACATTCTGGTTCTTGGAGAATTCACGCTTTTTGGT
ATCAAACCCCAAGGAGAGGTATATCTGCAGAAGCGACTAGGCTTTCACCCATCGGCATTTTGTCCGTTCCAGCGCTGGGCATCACCTACCGAGCGGGGTA
CACCAAACACCACTGCGCTGGAAAACCTGCTCGTTGCCAGCGACACGAAACTGTGGAGTGTCTTCAAGGACAAAACACTCATTTGGTCTGCTTGTTCCTC
GGTGGTTCCCGTGGCCCTCCAGGTCCGAATTTGGCGGCATAGATGGAATGATCGTGAGCCTCGACTCGGATGGAGCGCTTTCTGTGAATTATATGGGTAC
AGATCCGCCGTCCTCCGCTGTTGTTGCACCAGACACAAAGGAAATCAACTATGAAGAGATGGATGGACACAGCTACTGAATGTCATTCGACGTGCACAAG
GCGAGCGACGGACGGAGCCAAAGGATCTCCGAGCCCAGGTGCCTGCAATACTGGATGCACTACCGGATCGGAGCGACGAGTTTAGTCGTGGAGGCGGGAG
CCCCGTACATGATGGCAAGAATACACAGCTGACGATGCGCGTGTACGTCACGTACACGGGTGCCAACCGTGTGTCCAATGTGACGCTATCGGTGTTGACT
CCCGAAAATGTGGCGGCTAGTGACTCCTCCTTCGTGATCGGGAGTATCGATGGCAAGGCATCTACGCCGCTCATCATTCCGGTTGTATTGCGCCCAAGTG
CTAATGCCAACCTCGTTATCCGTTACCATTTCAGCATCCTACACACTCGAGACAGGGCAGCCTCGTGTCTCAGTGTGTTGTGAAGTTGCCCATGTGCATG
GCGTGCGCCTCGTGCCTCCCGTCAAGTCGAGCACCTTTAAATTCACCCTCGAGACTAATCAAGAGCCGCTGGAACTTGCTAGCCTGTTCGAAGACATGCT
T