Description :
From Genome Similarity Track
Location :
Scaffold_85:152581- 157880
Sequence
5299 bases(100 bases per row)
ATGAGGAGCTGGAGGAGGGGCTACGCGAGAATGAACGCATTAACGCGACACCCATCCAAGAGGATAAGGAAGCACGGAAACGACGCATGAACAAGCGCAG
GAGGAAGCGCCATGACTTGAACAAAGAGCTGAAGGCTCTCAGCGTGCACCAAGACGAGACATAAGTCACAGAAGCGACGGAAGTTCCGGCTGATCGTGTT
GAAGAGCAGGAGGAGAAGACGGAAGAGTCCGATCCTGCGGTACATCAGCACCGGTTTGCGGCCCAAATGGAGGCAGTGTATATAGCGGGTGCCACCGAGG
TGGCTTCATTGGCAGTGCCTGTCGTACTATAAGCTACCGTTCAAGAGCGAACCCCTATCTCGCTTGGGCAGCGCGCTCGCGGAAACAGCGATACACTATC
CCACATAGACCGCCGCCGTGCCGGGGATGCTGAGAGGGCCCGTACCAGAAGAGCCAATATGACGCTCTCTCAGCGTGATCGTACTCATAAGAAAGACGCT
GAACGCAAACGCGACCGTAGAGCCCAATTGCACGGTCAGGAACTTAGCGAACGACGCAAGCAAGCGAGAACCCGACTACAAGAAAGACGTGCTGGTTTGA
GCCAACACGATCGTGACTGCGTGCGAGAGATCAATACTCTGTCTCGCGCTGAGAATCGACAGTTGATGGATGAAAATGATCTTTCCGCTCTTCGGGCTAC
TAACAGGGAGCAGCACGCAGAGCACAGAGCGGAGCAGTCTGAACAGGAGCGGGAAGCCGAACGTGGGCTAGACCGGCAACGACATGCGGATCGACGATCC
CGCCAGACAGAAGAAGAGCGCCAACAGGAGCTCGAGCGGGTGCGCACTAGACGCCAATGCACCCGTCATGGACACGCGCTAATATCCCTTGAAGATTTTG
ACGCGTCCATGATAACGGGTAACGACGTGGTGAACGGTCGTCACAAGCTCCCGGCCACAAACGTTTGTCCGATCTGCAATGCTTGGAAGTGGCCAGGCGA
GTCGGCAATATCATGCTGTCTGGCAGGGAGGGTAAAACTACCTCCACTGCACCCCGCGCCACGGACGTTGCTTCCGTTGTACGGAGATCCAGAGTTCCGC
CGTCAAATTCGTGCCTACAATCAAGCCTTCGCGTTTACGTCGATTGGTGCTTCGTGCTCAAACCGATCGTTTCAAAATGTACATCAAGACGAGAGCGTTG
CGGGTACACACGGCGTGTACACATATCGCATTCAAGGGGCTATGGGGCACTACCTAGGGTCTCTCCTCCCCCACATAGACCGTCGGACAGACGCGCGGGT
AGCTCCAAGGTTTGCTCAGATCTACATTGTGGATCCGGACATGCAACGCCGCGCGGAGCGACGTCTTGGTATATTCGCGGATCTGGATCATGTTGCACTA
CTAGATATCGAGAAAATGATGGCAGAGCCAACCCATTAGCGCAACGGTTCCTTCACTTTGGGCAGCAATTGCGCCAACACAACACGGAGGTTCCAGTAGA
CTTGGTCTTCCGTCTGCATGATAACTCCTCGCGACCGCGGACGCATAATCGCCCCACTGTGTCTGAGGTGGCTGCGACTCTCATTGAAGATGGCAACCTG
GCTCAGCCTCGGGATCTACTGCTCTTTACACGCGATCAAAGGCTGCTACGTTTGTACGAGACCCACGCCGATTGCGATCCACTTCAATACCCTCTTCTCC
TTCCATATGGAGAGAAAGGCTGGACCTACACAGACGAGTTCGCGAATGGTGCTGAGTATCGAAACAAGAAAGCGATGTCGCTTCGTGAACACGTCGCGTT
CCGCCTTCATCAGAAAGTGGATGATCAGTCCGCTCTCCACCAAGGCGGACGACTATTTCAACAGTGGTGTGTAGATCAGCGTGCAAAATGTGAACAAGAA
CAGCTTCGTTGGGTGGCTGACAATCAGAAAACACTTCGCACCGATCAATACAGGGGTGTTCAAGACGCTTTGCTCAATGAAGGATACTTTGGCTCTGGCG
GAAGGAGAAGTGCTGCTGTCGGAATATGACCGGGCCCAGAACAGATTGGTGCACCCGGATCGGGACGGAGGCTGCAGAGGACGACCAACCCACTTTCTTA
ATCAGGTTGGCAAGCGTATCATACCACCGGCTTCACACCTGGGTAGCCGGCGGTCCATGTACAAGTCGTATCAAGATTCGATGGCAATTGCTCGGAAGTA
TGGACGGCCCGACGTCTTCCGGACGGAAACGTGCAACCCCAAATGGGACGAGGTTCTTGAAGCGATACCTTCCGATCTCCAGACAGCTCAAGATCGACCA
GACATCGTGGCTCGCGTGTGGCAGCAGAAACTGCAAGCGACGCTTGACGATTTAAACCAAGGCGTTCTGGGGCGAGTGCGCGCGCGGATTTACGTTGTCG
AGTTTCAAAAACGAGGGCTCCCCCACGCTCACGTATTGGTTATTCTGGCTGACGAAGACAAACCTCGAACGCGCGAGATCGTAGACAAGATGGTATGCGC
TGAGATCCCAGATAAGGATACAAACTTTCAGCTGTATGAGACGGTCATGTCATGCATGCTCCATAGTCCATGCGGGCCTACAAACCCTTCCTGCGCTTGT
ATGAAGGACGGCAAGTGCACTAAGGGGTATCCGAAGCCCTTAGCAGAAGTTACACAAGCCAATGCCAATGGTTATCCAGTGTACAGACGACGTCGACGGC
AAGAAGGTGTTCTAAAGCTCAAAGGCAGGGAATACGACAATGCTACGATCAACCAGTGGGTTGTACCTTACAACCCGTACTTATCCCAGAAGTACAACTG
CCACATTAATGTGGAAGTGTGCACGGATATAACTGCGGTTAAATACCTGTACAAGTATGCGTACAAAGGACCCGACATGGCAATACTCACTGTGGAAGAA
GTCCGAGGAGGGCAACAGAGTGCGCGTCGAGAACCAAATGAGATTCTACGTTTCTTGAGCGCCCGGTACATTTCTCCGGTGGAAGCTTGCATGCGCCTGC
TCGATTTCACGATTCAGGCGAAATCTCATGCGGTGACACAGCTAACGGTTCATCTCGAGTCAGGCCAGACAATTTGCTTTCGCGAGACAGAAAACCCGGG
GGCGGTTTTGGAACGTGGTAGTCACACGATGCTGACCAGACTCTTTGAGCTGTGTGCGAGTGAAGAGCCTCAGAATCATATTGCCAGGACGATGTTGTAT
CAGGACATCCCTAACGAGTTCTGCTCGAAAGCGCCGGAGAAAAGGGCAACCGAAAATGTGGGTTCGCCGGAAACAATATCAAGCTGCAGCTGGTCGCATG
ATTCACGTGTCTCCTCGCGATATGGAGCGCTTCTATCTTCGGCTACTGCTCTGTCAGCGTAGAGGGCCAACGTCGTTTGAAGACTTGAGAACGGTTAACG
GGATTGTCTGCCCCACATTCCAAATTGCGGCGCGGGAGGCTGGCTACTTGGAGAATGATACCGAGTGGGTTTCGTGTTTGAGAGAAGCGGCTTACTTTCA
AATGCCGTATCAACTACGCCAGCTCTTCGTCACCGTTCTGGTGTATTCAGCTCCAGCAAATGTTGGTGTTCTATGGGATCGGTTCTTCGCGGATCTTTCC
CAAGACTTCGCACGCAAACATCAGGCTTTGATGAACCCTTTCAAGTCAGCGTTGGTCGAATTTGAAACGCTGATGAGCATTCAAGATCTACTTCAATCAA
GTGGGTATGCGGTAGCTGACTTCGACGAGCTTCCTCAGTTGGGGTCGTTCCCAACATTGATTCGTGAATCGCTTCGCCAAACCGGATTACTACGACGCGA
GTTCACTGGATACGATGCGTCAGCTTTTGAGGCGACTGTAAATACAGAAGATCAGCTGAACGAAGGACAGCGGGTGGTTTACGACCAGATTATTGAAGCG
GTAGACCGTTCGCAGGAAGCCAAGAAGTTATTTTTTGTCGATGGCCCGGGTGGTACTGGAAATTCTACACTGCTTCGAAACATACTGGCCAAAGTCAGAC
CCTCGGGGAAAATCGCCATCGCTGTTGCGTCTAGCGGTATTGCCTCGCTTTTGCTCATGGGTGGTAGGACATCTCATTCTATATTCAAGATCCCTTTGAA
ATTGAACGAGAGCTCGACGTGCGGTATCAGGAAAAACTCCCATATTCAGGCGTTCATCAAGCATGCAAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN