Description :
From Genome Similarity Track
Location :
contig_71:152566- 157969
Transcript NameFunction/comments
g11399.t1ETI41308.1 hypothetical protein F443_13445 [Phytophthora parasitica P1569
g11400.t1OWY97541.1 hypothetical protein PHMEG_00031910 [Phytophthora megakarya

Sequence
5403 bases(100 bases per row)
CAGTGTCAGTGTCGCTCTCCGGGAGTTCTCGGTGATTTATCGTGTAGCGGTGGGGAGCACGAAACTTACTGCCGAGCATGACGCCAAGTGATCCAACAGG
CCCCGGATCACGCGGGCACGTTTTTGACCGCGCGCTGTCCCAACTTGATTCACGCGGATGCACTGCAACTCTCCCGCGATCAGCGCTCGCTTTGCCGTCG
ATGAAAACTTCGCTCTTCTCTCAATGTGTACACGTCGTTACTCCGATATGGCAGCCTGTCGACAAGCGTTCTTTTGGCGGGGCAGTCTTGGGCAGGAGTA
TTGGCGCTGGTGTCCATGCGGTGGTGGTAATAATAGTTCATTCTAAGAGATACACCTCGTCATATCAGATAGTCACCGACAACAGACCCTTTTTAATCAG
ATAATAGTGTCGCAGGTCATTTTACTAAGAATCAACAAAGTCTTTCCATCTCGATCTGTAACCACGTATGGTCCATATACTAATACAATTAATTCTCACA
GGACAACGACCTGCTTCAGAAATATGCAGCAACTTCAACTATTGCGTCGCGCGGTCTCCGTTGACGGCAGCCATTCCTTCATTTCCCTCGCCCCAAGGAA
GACATTTGCACTACAGGAAGCAGCAAAACACCCCTATGACAGGTCTATCCGACACTGTAAACTCGGATGAAAATCCTCCACTGGCGGAGCTGCGCAGACT
CAAGTCGCAAGCGCAAAGTGGCGAACGTCGTCGCCAACTTCGACGCGAAGCCCAGAAGATCGAGAGCAAAAAGCCCAACCCATCGGACCCCGAGCCACAA
GAAGCAGAGATGGACGAAGCCGCAACGCAAGAAGAAGCGCAACTTTTTCAAGTGGCTGCTCACGCCGTCTGTGGCGACCAACCGCCAAGTGGCTCCTCCG
AGAGTTCGCGTCAAGATCCCCATCGTGTATCGCAACGGCGAGCACAAAGGCGTTGTGGTGGGTGGAGTGCGGGTGCCATTCTCGCGGCCAATGCAGGCGA
ACCGCCGACGTTTGTTGCTGTCTCGAGACGACGTGAGCTCCGTCATTCCAGAGGACACGGAGTTCGTGCTGGAGTTCCCGCCCAGACTTGCTCGCGAGGA
ATTCGAGACGGAACACAAGCGCAAAGAGCAAGAGAAGAACAAGTTGAAATACGAGAAACTGGCAAAAGAACTGGCCAAGTAAGTGGTCGGCACTGCCTGT
CGCCGTGTTCATTCAGAAATCACCACCAAAGTCTCCACCATCGAAGCCACCACCACCATCGAGGCCATCACCACCATCGAGGCCATCACCACCGTCGCCA
AAGCCGCCTCCATCGCCGTGGTCAGCTAACGTCTCTCCGAGTAAAAATCCACCGAGAAGACCAGCAGCTCCGCCCAACGCAGCCCCAGTGCCGGCCCCCA
TACCACTCCCTCCATTTCGACCGTAGTACCGACCGTATGCAGGGGTAGCAGCACTCGCAAACGGAGCTGTAGTCCCGTATGGCTGATCGGAGCTTCCTCC
CGGTATTGGACTGGAGACGGGAGCTGCCATGGGGATCGCACTATCCGCGCCGTGCTCTTTAGCCCGTCTAACAGCATGAAACAACAGCCACCGCAGCACA
AGACCAACGCTAGAGCTCCCAAGAACCACCACAACCAAAGTAGACCACCGCCATCTCCGTCACCTGCGCGGTACGGGGCATACCCGCAGTTGCAGGCGTA
ATTGGAGACCTTGCAGACGGCGTCATCGGGGCAGCAGCAAGGTCGTCGTTCGTTCTGGCGGTCCAGCCAGTTGCCACAAAATTGGCCATGCGTACCATGG
TAGGCCCGAGAGCAGTCCCCAGTGCTGGCACACACGTCGCAACCTGACTGCGTGCCGTTGGTTGGCCCGAGGCTGCGTGGATCACCGCAGCGAGCGTTAA
CAGCCTCCAGAGCTCGATCATCGCGATCTCTTGTTACCGCAGTAACTATCGCTTCTGATCACTTTCGCAGACAAGAACTTCCTGTCTCACAAAGCGGGAC
AATTACAGACTACAACCATGATTAGAAGGTAGACAGATTGGACCAGACTTGATCTACACTACTGTGATTAATAGATTAACTTTTGTTGTAAACTGGAATA
TGACGTTTCCTGCGGTGTTTGGTTATCTACATCGTGAAAGGATTATTTAAAGCGTCGCGACGCCTCGGATACAAGAGCTCCCGCAGATTTCAATGGCACC
GCTCAAGATCCTAATCGTTGGGCCCAAGGAGGCTGGCAAGTCCACCGTGCGTCGATGCAGTAAGCTGCAATACACTCGCTGTGACGTTGCACTCACCGCT
TTGTATCTTTGCGCTCTATTCTTCAGATCGCCAACTTCCTCGCAGAACACTCGGATCGACTCGGCGGTCAGGAACGATACCAACCCACTATGGGGTGCGG
ATTCTCGAGCTGGAGAAAGGCAAGGCGACCGTCGAGCTTTGGGATGTATCAGGCGACCAGAAGTACGCCTCCTCCACATCCTATTACTGCTTGCCTTGGT
CTCACTCGCAACATTATTCATTTCTGCAGCTACGAAGCTTGTTGGCCAGCTATCATGAAGGACACAGACGGCGTCATCCTCGTTTACAACCCGGAGTCTC
ACGTTCACGAGAGCGAGGCGATGCTTTGGTTCGTGGTCGCCACCAGTGTCAAGTATTTTCAATTGCTCGAACTAACACTGTTGAACGATTAGGTACGAAT
GGTTCATGCAAAGTGCCGGCTTGGACAGCTCTCAGTGCCTTATCTTCGAGCACTCGACGGGTAGCAACAACGCTGCAATTCCGATAGCGTCAAAATCGCG
TTTGCCAAGTCATTTGCGTGTCGTCGCAACTACATTCGACACGCCCAACGTCTTCAAAAGCGAGTTTAGCCGACTCGTAGCCGCTGCACTCGAGCGCCAG
CAGCGTACGGGAAATCGCAAGTGAAGCGGCCATCTTTGAGATGTAGCACGACAATCGTACGTTAGCGAAGAATCGTCACGAAAATGCTGTTTTCATGAGG
TACATTGGTGTCACTTAGGCTTTCGTTACGACGTCCTACATGTAGCTATCATCCTCAGGCATGCATGAAAGGTAATAGGGACGCCGAAGACCGTTTTGAG
GACGACGGCATGCTCCAGCGACCAGTAGTTTGGAATTGAGCCATTACGGCGATGGGTGGGACAAAATAGTGTGCTCTCGTGTGTTCCCGAGCCTAAGTGT
GGTGCTGTCTTTTGGGTTGGAACTGACAAACGTTAAGTACTCGCTGCAACAGAGGTGCATGGCCTATTGGGGTTGCTTGCAAGACACTCAGCTATCGATA
ACTGACGGCGCGTCACTCGCCATGATGTTAGTCTACAATCTCCTTCTTTGTTCTGATGCGCGTATTGCGTCAAATGGACACATATTGTGGCCATACTTTG
AGGGTTAACATGTCTTTGACCTACATTTCCTGCCCTCATAATACAATACGTTAACGCACTTGACAGCCTCGTTGCACTGCCTGAATGCTCAGTGTCTGAG
CAGCGACGATTGAGCTATGTGGTAAAAATTTGCCGCAAAATGCTTGCGCGTGGATCCGAGACCAACCTGCTTCGGCAACGAAGTCCGCAAAGATCGCAAG
GAGTCAGGCTTATTAAGGGGTATGAAAAGAGATTGTCTCTCTGTTCTATTGAACCAAATGCTGACTACAATGACGCCCCCCACACCTTTTAAGCCACCGA
GCTTCCACGGGGTGACAAAATCATCCGGAACGTATCGGTCGCCGGTCGCAGTCGCGTACATGCCCAGCAACGGCGCAACATCTTGACAAATGCTTTAGGC
GACAGTCTCTATCGAGTCCCAACATCCAACCAGTCTGCATCGCAACCAAATTGCGAAAAATAAGACCCGCTGTTCCTCATCGTGTAGAGTGCCATTCCGA
GACTTACCCCCCACGCATGCTTTGGCCAAGGATCACGTGACGGGCGGAACCTTGCAGTGCTCATTTTTGCGCCGCAAAAGTCTTCAATGCTGGCACTATG
CGACTGAACCACGAGCACCCCAAGCGAAACCCATTGAATCAAGAAACACCTTATTGAGTCGACTGTTTTACGTAGGAGTGGCCGCTACGAATCCTGTTGA
CAGTGTTACGGAGAGCTAGTCCCCACACTTCCTCCGGCCATGGGAGGTAAATCGTAGCGATCCTTTTGCCTCCGTTTACAAAGAATTGTTCTGTGCAATT
ACTATGTAGCCGAGATCGCGATGAGAGCAGAGTTCACAACATTCATTCAGACTATTGGGTGGCAAGGACTACAGTTGAACCAACCAGAAGATGCGATCCA
CCAGTTCACGAGATGTTTGCGATTGCGTTTCGATTCGGGATAGCATCATCGCTACTTGTACATGTAATCGCACTTCATGTGACACTCAAAGGGGCTAGCC
AAATGGCGCGTTGAAGTGCCTTATGCCGCAATCTTCCTTGAGAGGCGTAAGTCTACAGCTTCAACCCGTTGATACACTCAGTCATTCTCAATCTTCCCTC
TGACCGCGCACATGAGCCCCCCACCAACCATGAAGAACGCTGTTTACCGATTCGGTGATCGCACTTCCTACAAGACCATCAAGCAAACCACGGAGCCCGT
TCCAGCCGTGCGAGACCACGAGGTGCTCGTGGAAATTCACGGCGTGACGCTGAACTACCGCGACCTCGCAATTTCCAAGTCCGAGTACCCCAGCACCGTG
ACGGAGCATGTGGTGCCATGTTCCGATGGTGCCGGGGTCGTGGTCTCCGTTGGCTCTGCGGTCGAAGACATCGACGTGGGTGACCGAGTCATCACCAACT
TCGACGTCACTAATCTCTACGGCCCTGTGCTCAACGGAGGCTCGCACCGACTGGGTGGCGTGCTGGATGGCATGTTGCGGCAATACGCAGCAGTCCCAGC
TCAAGCAGTGATTAAAATTCCGGAAGAGTGCACACTGGACTTCGTGCAGCTTGCGTCGTTGGTGTGTGCTGGTGTGACGGCTTGGAACGCGTTGTACGGC
CTTGCTCCGCTGCGTCCAGGACAAGTTGTGCTTCTTCAAGGCACGGGTGGCGTCTCCATCTTCGGTCTGCAGCTCGCCAAAGCTGCGGGCGCCGTCACGA
TCATCACTTCCTCTTCAGACGAGAAACTCAAGTTTGTCAAGGAGAAATTTGGCGCCAGCTACACCATCAACTACCGCACGACGCCGGATTGGGCCGCCGA
GGCGAAGCGCATCACGAATGGCAAAGGTGTTGACTTTGTTGTTGAGAACGGTGGCTCCGGAACAATTGCCCAGAGCATTGACGCGGTGGCCCCAGGGGGT
CAGATTGGCTTGATCGGCTTCTTGGCCCGTGCAACCCAAGAGAACATGCCGGATGTCGCGGGGCTCGTCCTGGGCAAGGGCTGCATCATCCGCGGCGTGC
AGA