Description :
From Genome Similarity Track
Location :
Scaffold_98:15254- 21641
Transcript NameFunction/comments
Phyag_g2012hypothetical protein PHYSODRAFT_491946
Phyag_g2013hypothetical protein PHYSODRAFT_497615
Phyag_g2014hypothetical protein
Phyag_g2015hypothetical protein PHYSODRAFT_354318
Phyag_g2016hypothetical protein PHYSODRAFT_313196

Sequence
6387 bases(100 bases per row)
GTAATCTGCACCGAACGGCGTGTTTGGTTCTCATACAGAAATTGCCATGTTGACGTGCGCAGTGTGATGATAAGTCGCACCCTGTTCGGAATGGTCCATT
CTTGACACCCTGTGAAGACGACCCACCGTGCGCCCACTGCCACATGAAGCTCTCAGCCTGCCGTCCGAAATGTCCCGATTGCAAGGCCCCGTGCCGACGT
TGTGGAGCACTACGCATGCGGCTGTACGATCTACCAGAGCGTGGCTACTCTGACGAAAAACTACGGCCGCCGATGATCTCGATGGTAAGTATTGCTATTT
CGTTCTTTCAGCTTGCCTCATTCCTTCCTCATGCAAATTTTATTTTCTCTGCAGAGTGACTTCACACGCGTGTTGGAACATTCGACAGCGACCGTTTCTC
CTGATGAGCTTAATCGCTTCGTGAAGTGGACGCAGGAGTTCGGACAAGAAGGCTAGACCAATGCATAGACAGATGACTCCGTCATACTAGTATTCATCTC
TCTATAGTTGCCATGTCATATACTACTTCGTCGCTCATTTCAGAGTGACTCGATCAGACCTCCCAACTCATCAGCAGAAAAGTGGTGTGCATCATTGCAA
AAATGGCAGGTGAGGTCCACTCCAGCGTTTCCCACGTCTGCTGCAATCTGCTTCAGATCGGCGGTGCCCATATCCTTGAGACGTTGTGCGTAGTTGTCTT
TCGAGCATCGGCAGTAGTAGTCCAGCGGCACACGTTTGCAGTTCTTATCCGTAATGCCAGCACCAGGAATCAACTCGTTTAGATACTCCAGCAGGtccgt
gttcttcttcagctcggTGGCTAAGAACGGGAGCTTGTCGAACGCCAGCTCCTCTAGCTCGTAGTGGCGCTCATGTGCCTCCGTTGGGGGCATCTTCTGA
ACGATGAGACCACAGCTGCGCGTGTGGTCATCGTCAGCTTCGCTATCGATTCGCACGATGGTTGGGACCTGCTCCGACGCGTCAAAAAACCGCTGCCAGT
CCAGCTCAGGCACCCCAGACGCCTCAATAGACGTGTTGTACGGCTTCGCAGCGCCGTATAGAATCTTGGAGACGTGCATGTGTCCTCCCCTTTCTGGCGC
CCCCGCGAGCGATTGATCTACGTAAACTGCTTTGCCTCGGACCTGGGCGACGGAACAAGTCGGTGAGACCACTGGTCTGGATTACTTACATGTCAATACT
GCAACAACATTGAGCGCACCTCTCCGACCGCCATCGCCTCCACGTAGAGTTCCTGGATGTTGGGCGTCTTGACCATCATCTTGATGCGTTCCTCGCCCTT
GAAAAAAGAGCTGAGCATGGCTGTGCCGGCCATGTACTCGCCCCAGAGCTTCGTTCCTTCGGAGGTGAGCGgcagtcgccatcgtcgcgCCACCTCATCC
ACTGCATTGCGCGCCATCACGCCGGACACGCGAAGGTTGCCCACATGGCAGCGCACCACGACGTCGCGCAGCGGCCGTTTCCACATCGCCAATAGTCAAT
CTGATGTACGGTACACATTTGGATGGTAGTCAACATGTTGCTTTTTTCCGACGCAGTAGGAGCTGCCGCGCGATGTCCTGGCAGCGCACACggtccttct
cctgcagctgcagcacttttATCTGCTTCCGATAACCCGACGAGCCGTCGCCCCCGGCAGTATTTGGCTTTCTGGACGATAATTCGCGCTCCGAGGCGGG
GCGAGGGAAAAGTGACGCCACATCGACCCTCCCACCTCCACCTGCATCTCCTGTAGATGGAGAACCCTGAGCTCTCGCAACCTTTTCACACGCCCGAATC
TGTTCCCACACTTGTGGAAGCGCGACCACGTTGGCGAAGCTGCTTACGTCGGCGTATCTGTCGCCGTTGAGCGGCACGTGGGCGGTAGTGTTGCACCCAC
GTATCGATATCTCGTCCGCGCTGAAACATCgtgcactgcagcaggaatACTTAGCGGTTGGGCCGTAGTCGATGATTGAGCCGAGGTGATACGCGCAGTC
TCTTAGCTCTATCAAGCTGCACTTTTGCttgcaaacgctgcagtcaAAGTGCTTGATGGAGCCCCAAATGTACCAGTACACAGCGCTCCAGGAAATGCTT
TTGTCGGCGCCGAGGTCTCGCAGAAACGCCTCGACCTGCCATCCCGATTTCGCATGGTGTCTCCCAATCAGCTCACCATGCACACCGATCTGACGTTTTC
CCTTCTGACAGCCAACAGAATCTCTACTATCCGCAACGAAGAGCAGTTCGCAATTTGCACACAACTCCAGTCGACTCCCGACTTGTTGCAGAGTCTTCAC
CAGGGCTTCTACCTTCTTCCGCCGCAGCTTAGAAAGGATCTTGTCCTTGGGGTcgtgcagcgtctgcagtaGTTCTGGCGTGCAGTTGATGGCGATcttg
gcgatggtggcgtcCGACAGACAGCCAAAGtccacgcgcagcagcataAAGTCTTGCACGCGCCCCGATATGAATTCCACACACTcttccacgagctcct
ccatctgcagGAACTCGGAGGACACGAGGATGGACGCAATGTTCTCAAGCGTGATGCACGGCCGCCACTCTCGGTCGCTCTGGTGCATGTACtgcatgag
cagctcgaagatcTCGACGTCGCAGTGAACCGAGatgtcgatctcgtcgtgctcgttgGCCTCGTTCAGATACGCGCGGAAGTacttcatcttggccagc
agtAGGTCGCGCTGGCACGTGAACTCCTTACTACTCTTGCGGTACTCGTCGAACACGTGGATCACCACActgcgcgacgacgacgacgccgcgGACGCGT
CGGGGACCTGCTTCATGACTTCtggcagcaccttgaagGACAAACACTCCTGCATGCGTTTGAAATGATAGCAACTATTGTAGCAGCAGGCTGGACGAAC
ATGCGGCAATCTTTTCGAGATGTTGTCGAGGTTTTTTGCAGGAGTAGTAAAACCacttgaaatttgtatgTGACGGTTTTCTTAGATGCGTGTGGCCCAC
ACCGAGCTTTTTTATTGGCGGGCAGTAGTAGTACCGCTTTCGAGAAGGGGAAACAAGGAAAGAAGAGCAGCCAGCCGCCCCGATCACCACGGCCCCATCG
AGTCTTGAGAGAACGCATACAGCAGCATGTCGTTCCCCGCAGGAAAAGCGCCAGAGCGCAAGAACTTCTTCAAGAAGGGAATCGACGCCGATGAGTCCCG
TCGCAGCCGCATGGAGACGACTGTGCAGATCCGCAAGACCATCAAGGAGGACCGCATGAACCAGCGCCGTCGTATGGTACGACTGCAACAGCTCACAGAT
AGCCCTCAGCAGTGCAGTAGCAgagatgcaggagcagcagacgcctcTCTCTGGCTGTGGTCTCGTGGGGATCGCTGGCTGCAGCCTAGAGTCGCGTCGT
ATCTTGCAGTTGAGACGGAGGACTCACTGTTATTATTGCTGATGATGTAGGCCCCGGCGGACAACGGATCTTCGGCGACGCCCGCTATGGGagacggtgc
tggagagATGTCGCTGGTGCAGCGGGTAAGCAGACGAAGTGGATACGTTGGTTGGAGAACCCAAGTGCTGATTGTTGagtgtggtgctgttgtagcTGTC
AGAGCTCCCGCAGATGGTGGCAGGTGTGCAGTCGAGCGATGCGGCCGTGCAACtcgaggcggtgaccaagttccgcaagctgctgtcgattGGTGAGCTC
TCATTGCATCTAGCAGTGCGATCTAGAAAAGGGAACCGAGCTAACGTCTAGCATCTTGTAAAATTGTGTTTTTGCAGAGCGCAATCCACCCATTAAGGAG
GTGATTGAGACTGGGGTCGTCCCCATTTTCGTGCAGTTCCTCCAGCGCGAGGACTTCCccacgctgcagttcgaggCAGCCTGGGCTCTGACGAACATTG
CTTCGGGTACCTCTGCCGATACCGAGGTGGTGATCAATCATGGCGCCGTGCCGATTTTCtgccagttgctgctgtccacgaACGACGATGTGCGCGAGCA
GGCTGTGTGGGCCCTTGGTAACATTGCTGgcgactcgatcgagtgcCGTGACATGGTTTTGCGTTGCGGTGCCCTGCGTCCgctcatgcagcagctgacT
GAGAACTCCAAGCCGACGATGCTTCGTAACGCTACGTGGACGCTGTCCAACTTTTGCCGTGGCAAGCCGCAGCCGCAATTTGAGCTTGTGGCGCCCGCGC
TCCCGACTTTGGGTCAGCTCATTTACACCCACGACGAGGAAGTGCTGACAGATGCTTGCTGGGCTTTGTCATACCTGTCGGATGGATCGAACGAGAAGAT
TCAGGCGGTGATTGAGGCTGGTGTGTGCCGGCGAATCGTAGAGCTGCTGATGCACCACTCTCCTTCCGTGCAGACACCCGCTCTGCGTACGGTCGGTAAC
ATCGTGACGGGCGACGATCTGCAGACGCAGGTCATTATCAACCTGAACGCGCTGCCGTGCCTGCGTGCACTTCTGGAAAGCCCCAAGAAGGGCATTCGAA
AGGAGGCGTGCTGGACGCTCTCCAACATCACGGCCGGCAACCAGGAACAAATCCAGTTCATCATTGAGGCCGACATTTTCCCGTCCCTGATTAACTTCCT
GTCGACGGCCGAGTTCGACATCCGCAAGGAAGCTGCGTGGGCAGTATCGAACGCCACGTCTGGCGGCTCGGCGGAGCAGATTATGCACCTTGTCAGCCTT
GGTAAGTTGAAGGTATCCGTAGCCACCTTGTTTTGTTGTTCTAATGCAGTTTTTTTCGTGCGTTTACAGGCTGCATCAGGCCTCTGTGCgacctgctgga
ggtgaaggacgCTAAGGTTGTGATCGTGGCTTTGGAAGGCCTCGAGAATATTCTGCGTGCGGGCGAGGCCCAGAAGACCAACGACATCAACGATATTGCA
ACGATGATCGATGAGGCGGACGGTGTGAACAAGATCCAGGCGCTGCAGTACCACGCCAATGAAGGTACGAGGACACTTCCTTTCGTGTACAATAGCACGT
GGTTCCTAACGATCTGCTTTGCTTTCGTTTGACAGACATTTACATGAAATCCATGAAGATCGTGGAAGCATACTTCAacggcgaggaagacgcGGAGGAT
AGCCTAGCCCCCGACACGGATGCTAACGCACAGCAATTCCAGTTCGGCACATCCTCTGACCAGCCGACCATGTTCCAGTTTGGCCAGAACTGATTGCGGC
AGTATCGCGAGGTAGACAGTAATGGATACGAGTGAGCCAATGGACGAAAGCAGGAGATGAAGTCTATGGAACAACCCGGGGAGATAGTGCTCATGCGAAA
TGTATTTCCCCGTTTGCTTTTTTTAATCAGAAAAATATTGCACTGCAGcatgcaagcagcaaccaaAGGAGGACTCATAACAGTACAGCAACCCGAGTTT
TGTTCCAGCTACACATTCGTCTACGTAGGGACTGCCACGAACCTACTACCCTGCTTGCGCATTAGTGCATGGCACGCTGCGATCACTTACTTCCCGAGCG
CTAGTACCTTACCAATAGCGATCGTCTTACCCTCTCGTCACGAAGAGTGAGGCGACCCAACTGAGGCATAGTTGCAAACGTCTCGATCGTGTATGCTCTG
GCCCACTTCAATTCGGCACACGCCTGACTTGTGTGATTTTGGATTTCATTGTTCGCCACTTCCTCTCACAACTTCCTCCATGGCACGGCATGCTTGGGTG
GCGGGCGACTCCGCGAGCAAGTGTTTCCATCGGAACAATTCCAATATTTGTTGTAATCTTTGCGGATTCCTGTCGTGCGcatattttttttatttttgAC
GTTGTTACATTCGTGCCACATTTTCGTTTGCGCATGTGTTTTCAATGTCGCGCCAAGCAAAAAGCAGAGACTCGTCCTCCACACAAGAAGTTTCCGTAGC
CGCTGACGTGTCGAAGGCCACTTACGACTGACTCCGGGCCATTTGCACTCTCGCCGTCGCGAAACGCCCTCCGCTCTACCTTACACAATGGTGCACTACC
GTAGTACGCGTGGCGGCGTCCGCGGCCTCAGCTTCGAGCAGGCGGTGCTTACGGGTCTGGCGTCTGACCGCGGCCTGCTGGTGCCCGAGGCCAACGAGTT
CCCGACGCTGCCTGCCGATGCGCTGGACAAGTGGGCGTCTCTGTCGTACCAGGAGCTGGCTGTGGAGGTCATGGggctcttcatcgacgagagcgagatc
TCACGCGCGCAACTGCGCTCGCTCGTGGCCAAGAGCTACAACTCAACCACGTTCCGCGCCGAGGAGGTGGCGCCTGTGGCCAAGGTGACAGACcagatgc
tggtgctcgaACTGTTCCACGGCCCCACGTTCGCCTTCAAGGACATCGCACTGCAGTTCCTGGGCAACCTCTTCGAGTTCTTTCTGC