Description :
From Genome Similarity Track
Location :
contig_88:152500- 153704
Transcript NameFunction/comments
g13042.t1XP_009526058.1 hypothetical protein PHYSODRAFT_314541 [Phytophthora sojae

Sequence
1204 bases(100 bases per row)
TACGGAGCCTTCGTTTTGCGTGAATGCTCGTCTGCGTGGTCGTACCTGACGCAGCCTGACTTGTGCTGTTGATGTGTAAGCAGACCCAACGGCTGTGGTC
TGACACCCGATGCCGTCAGACCAATACGCGGTTGTGCATTCAGCAAACGTGCACAATGGCAATTTAGTTTAGCTGGTTCACTTCAACGCCCAAATCTTTG
CGAGTCTTGTCACGAGTTGTGCACAGCATTAACTAAAACTACATGTTGTGGCGCTTATTCACTTTTCTTCAGCTCTTCGCCTCAGCTTTTGCGTCCTCGG
TGCGAAATCGAGAACCTGCACCCCAGGTATATGCACGACTTGAGCACTGACGTCACTCCTTCCCGTGTGATCATCTTGTCGTGCTCGTCCAGCAGCATGT
ACGGCTTGAGCGATGGGTGTGTCTTCGCGACCTCGTCGAATTCCGGACCGAGCCGCCAGCCGTTGGCCGCGTACTCGGTCGCCCACACCTCGTGCGAGTT
TTCGGCAAGCAGATCGACGAGCATCATGACATCCCACGATAGCTGAACATGGTCGACGGGGAACGGGACGTCTCGCGTTTTCAGCTTGGGCGGGCGACGG
TAAACGTGGACTCCGAGAGCAACCACACACTTGATGATTTCGTCGACGGAGCACAAGTTGCGACCTCGGGCGGTGTCGTCGAGCGCACGCATCGGCAGCA
TGCAAGGGTGCACCAAACGCGTGTCATCTCGCACGTCGCCGTACTTCCAGCCAGCTAATGACTTCCCGCGGCACCAGTCATAGTGCATCTGCGACGCGAC
AAGCTCCCGGTGTGGCTGGAACCATCGAGGAAGTGCCGTCTCCGTCGTAACGATTGGATTCGGAAGGTAGTCCTCACCAGTCTGAGGCAATGAGGTGTCT
GCTGAACCCTCTAGCGCCAGGTCACCTAACGTATCATGGCGAATCGCGGCTGCCATTTTCAGGAACCGGTTCTGGTGCACGGAGACGGCACTTCCCAGCT
CGTGATCTTCGATGGAGAGCGTCGGAGCTTGCTTCAGTGCTTCGACCTGCTTGCGTAGGCTCTTCGAGTCGATGTTGCGGTGCGTCCAGCGGTGCTGCAA
AATGCCTTCCAATGTGATGCGCTTCTCCGGGTCCTTCTCTAAAATCTTCCCTAACAAGTCCTTTGCGTCAGCGTCTGCGCATGAGGCAGGGTACTCGAGA
GGAT