Description :
From Genome Similarity Track
Location :
contig_5:152490- 159735
Transcript NameFunction/comments
g1315.t1hypothetical protein
g1316.t1hypothetical protein F441_19099

Sequence
7245 bases(100 bases per row)
CTACTCTTTTCTTCTCCCCTTTGCTGTTCAGACGACGCGTCTTCGTTGGTGGACGCACTTCATCCACACTGCACTTTGGTGCATGAACCAGAGGTATAGC
TTCGTCCACGCGGCGCCTTTTCCTCTGCATTTCCTCCGGGGAAATAGTCTTGGACGTGGCACGCTCACCACTCGAGGGGGTGACTGTTTCTCAGCTGATT
TGACGCTCGAGTTCCCCCCTGCTCCTTCGTTGCCATAGTTTCCTCCATCTTCCTCCGGGTAACTACCAGGGTTTGCTGCAGCTTCCAGAACCTGGTGCCC
TCTTGTTGATCACGTGGAGGGCTCTGAGAATCTTGAACCAATCGAGTACACCCGCCGTCAACCCGTTGCAGGTCGAGACGTTCTGGAAGCAGTAGAGCTC
CCTCACACCCACGTCTGGAGCAAGTTTCAACCCAACTCGAAGCAGTCGCTCCCATTTTTCCTCCGTCATCACCTGCAACTCCTCCACGAACCCCGCCGCT
GTAGCGGGCCACACAGCCACACACTTCCCATCAGCACTCGCCAGTGCAGTCTCCGCCTCCTCAAAAGCTCGCTCCAGTGTCTTTATTCCTTCCATTCCGA
AATTGGCATCGACAATTGGACTTCAACTGACTGACCATCATTCTTGTGTTTAGTGTTCTACACCTCAAATAGGTCTTACGCGGGAATAACCGTGCTCGCC
ATTTTTCAACGGCAGTGCGCGCGGAACTGAGCGCTTCATTGACAGGTGCTGGCGCGCGAATGGAGTCTCCGCGGCGCCCGTCGGCGGCGTCTGGTCTGTA
CCAACGTCCTGTCTCTCTGACTCGTCATTTTCGCGGCCCGACAGCCCCCTCCAACGCCCGAACGACAGCTTCGCCGAGTCTCAGCAGTGCAGCGCTGACC
CGAGCGCCTTTCTGGGATTCCACGTGCCTCCGAGCGCCGAGGAGGTGGAAGTGGAGCCTGCTCATCTTCAGCAGAAGCAGAAACAGACCCCGAAACTGGT
GCTGAACCTGGATGCGACCACGAGAGGCGACAACGGCTTCCGACCTGCGACGTCGTACGAAAGTTCGATACGCACGTCCAACCCGTTCAGTGAATTGTTT
GAAGGCGACACGCAGGATGATGAGAACGTGGTGATAGACCAAGTTGCTGGAGAGAGACGAGGTGAACTGGTTCAGAAGAACATGAAGGAGGTTTTGCCGT
TGAAGAGACGGCGACAACGTGAGGATGACGCAGGTGCAGACAGGTCAAGTCCCCCGCCTACGATGCTGGCGTCGATGGAAAGTGCGTGGCGAGCTCGCAA
ACGGAGAGTGGCTGAGAGTTCACTGGACCTGAAAGGGTCGACTGGAGAAGTGGATGCAGCACAGAATCAGAACGGCCAGAAGGATGTCCAGGAAAGTTTG
GACGCAGAGACGATGGATGAAGCACGCAAATTTGCTGCTGCTACTGATGCAACAGTGAGTCAAGAGAGTGCTGGGGGGAAACGCGCTGATGACTCGCTGC
CAGGAGCTAGCGCGTGTTCGGAGTATAGTGAAGACCTTGCTCCGCGGATTTTCCAGGCTATGGTTAAAGTTCCACCAATGAGTCGATTATTCATGAGAAT
TGTGGCAAGAATTCGACAGACCATGTTCAATTTGATACCAGTGCGATGTCAGAAGACAGCGACCGGGAGACCGATTACGAGGATGAACTGGAGTGTACAC
AGCAGCTTGACGATGATGGGGCTATTGACGATATGGACATGACTCGCAGCTATGAAATTGGAAGCGATTGCGATGAAGAGGATACAGAAGTATACCCTTA
TTCTGATACAGGCACTTTACCATACGGGGCCGACTCGACCATTCTAGATGATGGCAACGATGACGAGGCAAATCCACAGAAAGAGACTGCGGGCAGTGCT
TCGAGAGAAGAAAAAATGACCCTTGTGCCGACGCCGGATCAAATCAGTGACCAGCGAAGAGCTGAGGACGAAGCAACGAGTCGAGAAGGGTCACAAACTA
CCCAACAGGACTATCTGACTCCAAGAGTTGTCCCCAGCCGATCTAAACGATCCGATGCTGCCGAAACCAGCACAAATTTTGTCGTCGCAGTCGCCCCTAG
TGGTGATGATGAGCAGAGCTCGCAGAAGTCCCAACATGACAATGATCCAGATGAGTGCGTGCCTACTCAACCTAGTAAACCTCGGGCGGAGAGTGAACCC
ATCGTCGAGCCGAACTTGCCTTCGCAACAAAACGTATCCAAGAAGAGCGATGTGCTTTTGACGAACGAGCATCTTGCTGGAACCGATTCTCAGGCAAAAG
CGATCCGCACACTAGAGTTTTCGTTCTCGATGCCTGAGTCGCAGGAAGGCGAGCCACACTTCAGTGCAAGCCTGCCAAGTGAAGGGGCAGCTGTGTCAAA
GAGATCAGAAACGTTCTCTCGCAGTGACAAAACAAGCCCTTTCGCGTCTTCTATCAGCCCGGTATGGGCGGCAATTCCAACCCCCATACCTGTAGAGGGT
TCTGCCGTTCCCGATGTCACTGGGGTCACGATAAGTTTGAAGAAGAAAACCACATCGCCATGTGATTTGCCGACAGGAAAGAAGCAAAAACATTCTGCTG
AAGGTACCGATTCCCCTAGCTCATCCAAGCCTAAGAGGAGTAAGCGCGGTTTTTTTACACCTGACAGTAGCAGCACGCCAAAAGAATCGGACGGAGGTGA
TCGCAAACTCCTCGGCCTCCTGCCCGCCGCGGCACTCGGTCCTCTCAGTCCACACCTTCATCAACCCTACAGTTCGAACACGAACAAGAACACTAACCCC
CGTGCCGTCACAGCGTGCATATGCTTCAAGATCTCGAACGCTATTCAAGTACAAGTTCGAGTTTTGCTTGACGGGCTTCGTGAAGACCGGTGAAGAAAAC
TTGAAGGAGCTGATTGAAGGTCACGGAGGCAAAATTCCTGAAAGATACCAGGATGTTCTATACAAAAACAACGTCAAAGCTGTGGTTATCGCAACACCGG
TATCATGGCGCAAGCGCAAGTTTATGCAAGCTGTGGCATGTGGAATCCCGTCGTTCATACAGATTGGATTCACGATTGTATTGAAGATGGCTATGTGGTA
CCTTTCGATGGCTATCAAGTCCCAACAGGCTACTCCGTTACCACTCGAAAATTCGAGTGTTTCCCCCTAGAGAGGTAAGTCCTCTCGAATAGGTCGAACG
CCTGGGATGGTTGAATGCAAAACTAACCTTTTTGCTGCGTGCGGTTGTGCGAACAGCTACACATTTTTGAAGGCTATTCCTTTGGTATTGTCAGTGACGT
GGCACAAACGTCGAAGGCAGAAGCGAAGGACAAGGCCAATCTGATGGCTTTTATTTTGAAGGCTTGTGGTGCAGATGCTGTATACGAGGTTAGTCCATCG
GTATCAGTAACACTCTGTACGGTCGATGTTTTGTCGTCCACTAACGCGTGTCGTGACTTGTAGAATCTGTCTACCAAGAGCGACGTTAACGTGGATGTGG
TGCTCTGCGACGAGTATACTCAGGTATGGAGCATTGATACCAACCATGCTGTATGATCTAGCCGTTTGACCGGTAATTGTGTATCCTTGTGTCGTCTAAA
ATATAGACTTGCCGGTACTACAAGAAGAAACGCCGCGTGCCGGTGAAAGACTTCCAGTGGGTTACCGAGTGCATGATCCTTCAGGTACACATAGCATGAG
ATAATCCGTGTGGTAGGAAATATCGTCGATCTGCCAACTAACACAGAGTTTGGCTGTTTCTTAGCGATGTCTGGATCCCGAAGAACCAGTTTTTGAACCA
CAGCGCGTAGGCTGCGTAGATGTTTTTGCAGCAAGCGCTGAAATTGGTGACAGCGACAAGTACGTTCTGGGCCTTGTTCTCCACGTACCTGTGAATGGCT
CGCTCATATATTCCTGTTGCGTCTTGGTAGCACGACCCTGAAGTTATACACGGGGGAGCTTGTGATGGCGGACATCTCGGGCAGTGCAGCCGACCACTAC
CTCCTGTTCAATGTCTGCGAAATCCTCAGTATTCACGTAAATGCACGGAAAGATGAAGGCTCGCAGTCAAAGAGGAAAGACAAAGGAAGCCGCGTTATGC
TTCGTGTGGGCATGTTGAAACGGTACGCTTTGCTTTGTGTAGTTGCTTGTTGCTGGGCTAGTTGTGTTGACAATGTTGCACTGTGTGTGGAATGAATAGC
GAGCCTTACAACCCCGAGCTGTCAAAATCCCCCGCCAATGTGCTGGAAATCTCATCATCACAAGTGAAACGAAGAAGAAGAGGACTATGGCAAGCTGAAG
TATAAGGATGAGAGTATCTTTTATTTGGAGGAGGAGAGCGATCTGAACAAACTCGCCGTGTCTGAGCACAGATGGCTGACACAGTGACTGCATCGTTGCT
CTGTTGTTAATGCTATCACAAAACGCCTCCGCTTCAGGAAAATCTTTCTTGTGCGTTTCACTCGTGTTGCTCTTCAGGGCCACCCTGATCTCGCGCATTT
CGTTCATCAAGAATCATCCTATTGGGGATGAATAGATGGAGCCACGGCTAACAACGCGAAGGAAGCCAATTTAGTAGGATTGAGAGTGAGGCTGTGCTGG
TGCTGTCAACTGGCACGTACTTTTCGCATAGGGTCGACACCAGTGTCTGAGAAGATGGTCTGTTTGGAGAAACAATCACACGCAGCATTGAATTCGTAGG
CTTTCCTCTGCTACCATTCGTGCAGCGTACCTGCCACGAAATAATGCCCAAGTGAGTAAGCATCATGCGGTAGTAGTTGGTGAAACTCTCGGCCAGAAAA
CTCCATTTACCACGCAGGTCCCTAAACCAAATCTGTGGTGCTTCTGCTTGCAGTAATAATGACTTAGCCACAGTCCGCAATATATAAGGAACAGGGAGTG
CAGTACCATCGAGGTAGACGAGCGCGACAGTGCCGTATTTTGTCGATGTCTCGAGAAAAAATCCTGTGAGTTCCTTGTGGTTGACCTAGAGCCAAAACCG
TGTGAACTCAAACACGTCGCCAGAATACAATCCAAATCACACTCACCTTTCTCAAGTCGAGTCGATGCTGATCTACGGGCCGGCATTGTGAGGGAGATCC
TTGATCGAGAACCGTTGCAATTCCTTAACAGGATTCAGCAAGAAATGACCAACCAAGGTGGAGTGGTCTGAATGATGCAATCAAAACAAAACAAAACAAG
CTGGTGTTCACAACGCTGCACTGCAACTACCCTTCTGCGAGATATCCTACCGCGAAATGGAGCAAACCATTTTACCGACAACCCGTTTGCGATCGAATAG
AACCGCTTCAAGTCGTCTGGAAGTAGATACGGGGAGTTTTTCTGGAGCAACGCATCAACGTCAGCATGAATATCTTTTTCTGTTCTGGCCTCCCTTCAAG
GTGTACACCTGCTCCCAGAGTCCAAGTTCCACCTGGGTAGCCCCAACAAACGGCTTCGACTCGACGCGCGACACGCGCTCATGAGCTTGCAAGTACGAAA
ACACTCCGAGGGAAATGGCGTCCAAATGCTGCATTGGTGCTGCCGAAGAATGAACGAGCGCTCAGATTCTAAGATAAGAGCTGCACGGGAACAGGCGGAG
CCGGCGTTGCAATCCTCTAGCAATATTACGACGGAATAGCAGCTATTACAACGATCCCTGAAAGTGCGACGAGGCTCGACTACATGATTGAGCACTGCTC
TTGGCCTGGGCCGCCACCAACTAACCACAAAATCAGCAAGAAGCAATCAAGAATTAGACTCTCTCCTGGACAAAGTATCAAAAGTTGGACTTACGTGGCA
TGCCAGGCATTCCAGCCATACCGGGGAACATGCCAGCGCCCTGCAGAACCCGGACATAACACAGTTAGACCCTGTACGTAGTTTCTGCTCCAACGTTGTA
AAGTAGAACGAACCATATTCGGCATAATCGGCATCCCTTCGTCATCAAACTGCAAGCCTGTGCACCGAGTTGAATAAAGTAGAAGTAAGACGCTTCTTTT
CAAAAACAACAACATTGACTGAGGCGTACCTGGGGCAAGGTCCTTCACGATCTCCGAAGGCGGTTGGCCGGTCTCCTGCATCTCCTGCATAAGCTCTGAC
AGTCGAGCGTAATTATCCGGCTCTGACTCGTACGCTGCGACGATCTGCTGGAAGTACTGGTACTGCTTGCCATATCTGCGCAAAAAAATAAACAGCTCAC
ATTCAGGAAGGCAGTCGACAGAAAGCACACACGGATACACAAATGCCTACCGCTCGTAGTCTTCTTTAGACAACAGCGACTCTTCTCAGCTAGCCACTCA
GGATACTACGCAAAAACGCAAAAAAAAACAACAACTCGTGATTAGCCTCCATCAAGCAGCAAAGTCATACCCCTTTCAGTACTTGCGTACCCGCTCGCAG
ATCTGCTTCATGGGATCATACATAACGTCCTTTGATAGCAGTTGCTGCATCATGCCGTCCACCAAGTCCTGGAAATCGCTCTGCCCCCAAAAATCACCGT
CAATAACCAGACACAGGAAGTCACTCAACTCCTGTAGCCACCGCACCTTTTCGCCCATCTCTTCAAACTTCTTCATCATCTCCGACATCATATCCTCGCC
CATAGCTTCCACCTGGGCCGTACCGACGCCCTCCATGTCTTCCGCCGCCTTGGCCATATTCTGCAGCGTTTTGGCCACGCCAGCGTTCACATCGTCCGTC
TCATCGGGCGTCGCGTCCACCTTCAACGAGCCCAGCAGCTGCTCGATGTTCTCGGCGTCGTCTGCATTCACCACAAGAGCATCAGAACCTCTCCATCAAT
CTCTTCACTTGACTCCACTATACCGTCCGTGCCCAGCTCTCGAAATGCCTGCTCCAGCACCTGCTGGAACTCGGGATTCTGCGCGTCCTCGAGGAACTTA
GCCATGTTCTGCCCCCATAACCACAGCGTCAGCGCTTCACTTCGCCTCGATCAAGTTCTTAACAGTTTTGATAACCTCTTGCAGTTTGTTGTCTTCGCTG
TCCCGCGTCGCAGCAGCGGTGGCGGCCGCTTCCTGCTGCACGGTGGCCATCTCCGAGGCTTGGGCGGTGCTCACCTCGTCCGCAAAGTCGTCCAGCGCAT
CTGCAGAGACGGACAGTGAGCGGGTGTGTGTGTAGGTGAAGGAGGCATGGGTGGTTACCTTCGAGGAGATCGTCCAGATCCACTTCCTCCTGCGTCTTGG
GCTCGCTCTCCTCCTTCGTGCTCATCGTCAGGCTCCGGTTGACGT