Description :
From Genome Similarity Track
Location :
Scaffold_640:15244- 17355
Transcript NameFunction/comments
g15251.t1POM77273.1 Integrase catalytic core protein [Phytophthora palmivora var. palmivora

Sequence
2111 bases(100 bases per row)
AAGTGATTGATTTAGGTCCTTAGTTCGCAAACTCCTTTGCTACCTCTAAGCCTACTGGATTCTCTACTGGATACACTCTACTGGATTCCTTACCGGATAC
TGAGTTGCTTCAGCCAATCAGCGACTGCCACGTGGATGCCCATCTTGTACCCACAATCTTGTACCCACGTGTCCCGTAATCCCCGTAGCGTAAACAGCGT
CCCATCATCAGTGTCCCGCGTCCCATCATCAGCGTCCCGTCAACACAGGAATGATTGCGGTCCCACTGAGTGAAGGTCATACCGGTATCCTACCGGTATC
CGGCAGCTGCCCGAGGCGCCTTCTTGACAACACTCCCACTCGACTCGACAGCGATTGCACCTTGGATCCCGAGCTTGGTCCGAAGAACTTGGAACTGTAC
TGCAGTGATCGCCTTCGTCATCATGTCCGCCAGCATGTCGGTTGTCGAAACATACTGCAGCACCACTTGACCGTCTTCCACCTTCTCGCGCACGAAGTGG
TAGCGAATGTCGATGTGCTTGGTGCGCTTGTGGAACTGCGGGTTCTTGGCCAACGCGATGGAGCCTTGGTTGTCCTCGTAGATCTTGACCGCTTCATCGC
TTGCCATCTCGCCGAGCTCGCACAGGAACACCTTGAGCCACACTGCCTCTTGTGTCGCCTCCGATAGCGCCATGTACTCGGCCTCCGTTGAAGACAGCGC
CACCGTCCGCTGCTTCTTGCTCCTCCAGCTGATGCATCCGCCGTTCATCATGAACGCGTAGCCGCTTGTGCTCCGTCTTGACTCGATGTCGCCGGCCCAG
TCCGCATCCGAATATCCGCACATACCATGGTTGTCTTCCCGTGAGAACTCGAGTCCATGCGTAGGCGTCGCTTGGAGGTACCGCAGCACACGCTTGAGGG
CTTGCCAATGCGTCGGACACGGGTCGGCAGAGAACTGGCTCAGCACTTCCACTGCAGCAGTCAGGTCCAGACGCGTTGCCACCATCAAGTACATGAGAGC
ACCGACGGCACTCCGATACGGCACGTTCTTCATCGTGTCTTCATGCTGGCAGCCACCCTCACACATGTTCTTGGTCAGCTTGAGTCCGGGGTCTTGCGGC
GTCTTCACAGGCTTGCTGTCTTGCATGCCAAACTTGGTCAGGATGGACTTGAGAAACTTGGTCTGCCGCACCGTCACTTTTCCGGAGTCGCGGTCGTTCT
TGATCTCCATCCCGAGGAAGTACTCCAGCTCGCCGAGGTCCGTCATCTCAAACCGTTTGCTCAACGCGTGCTTGGTCGATTCCAACAGCTCGTCGTTGCT
GCTAGCGAGGACCAAGTCGTCGACGTAGAGCGCCACGAAGATCATGTCTTGGCCGTTACGCTTGAGGTAGACGCAGTGGTCGGACTCGCACTTCTTGAAC
CCCAGCTTGAGCATGAAGTCGTCGATGGTCTGGTTCCACATGCGCGGCGACTGCTTCAGTCCGTACAGCGACCGCTTGAGCTTACATACGTGGTCCGGGT
GGTCTTCGTCCACATAGCCATCCGGCTGTGCCATGTAGATGTCTTCGTCCAGCACACCGTCGAGGAACGCAGTCTTGACATCCATCTGGTGCAGCTTGAG
ACCATACTTGGCAGCTAGACTCAGTACGATCCGGATGGACATGAACTTGGCCACTGGTGCGAAGGTCTCGTCGTAGTCGATGCCGTACTTCTGCGAAAAC
CCCTTGGCCACCAGTCGCGCCTTGAACCGCTCAATCTCTCCAGCTTGGTTCTCCTTCACGCAAAACACCCATCTGCAGCCGATCGCCTTGCGTCCCTTCG
GCAGTGGTACGACATCCCACGTGTCGTTCTTGAGCAGCGAGTCACACTCCGAGTCGCACGCCTCCTTCCACTTGACTGCGTCGGTGGATTCCATCGCCGA
CTTGAACGTGGTCGGCATTTCTCCCACTGAATCCACGACGTACGCAGCTTCGAAGTCTTGACTTTCTTGAGCCGCAGCAGACATCTCGTCCAGAGTCTGG
TGTCGACTCTGCGACGCATACCGCTTGGCACTCGGAACCTCCGTGACTTCCTCCAGCGACTGCGTCCGCGGGTGTCGCTTGTTGCCGGGCCCGAAGTCTT
CGTCCCGCGCA