Description :
From Genome Similarity Track
Location :
Scaffold_63:152436- 153457
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G014385Similar to HI0131: Uncharacterized protein HI0131 (Haemophilus influenzae)

Sequence
1021 bases(100 bases per row)
CTCGGATGCGCCCGCGCCGACCTCTCTGGAGAAGAGACCAAAACCCTGGACCAGCTCTATCAGGATGCTATCAAGGAAGGTGGTCAGCTTATGGTTTACC
ACGGTGGCGACACTGCGGGACGCCAAAATGGCCTCCGCGATGCATTCATGAAGGTCTTCTCAAAGATCAACACCACGATCATCGTCGATTATAGCAAGTA
CCAAGACGTGCGCCTCGACAACCAGTTCGCGACCAACAACCTCGTTCCCGACGTTGTTGCGCTGCAGACGCTGCAGGACTTTCCGCGCTGGAAGGACGAA
GGTCACTTGCTGAACTACAAGCCGGCCAACTTTTCGAAGATCTATGACGGATTCAAGGATCCAAATGGCGCGTGGTATGGGTACAGTGTGTACGCGTTCA
CGTCCACCTCGAACGCGACGACGCTGAGCGGTTTGCCAGTTCCCAAGACTCCGCTTGAGATCGTGGACCCCATGTACAAGGGGCTCATCGCGTCGTCGTA
CCCGAATGACGACGATGCCGTGCTATTCCTGTTCTCCAAGTACGTCGAGAAGTATGGTTGGGAGTGGGCCGCCAAGTTCGCGACGCAAAACGTGTCGTTC
AACCGTGGCACTTTTGTGCAGGGCGATCTCGTGCGTGCTGGTACGAAGGCGATCGGCGTGGGCGGCGGCGGCAACCATGCGGCTGCAGTGGCTGGTGGGT
ACCCGTTCCTGGCCTGGGCCCAGCGTCTCGCGATCCTGAAGAAGGCCAAGAACGTCGCTGCGGCCAAGTTGTTCGTCAACTGGCTATTCACTGAAGAGCG
CCAGCGCGCCGCGGCGTCCACTGGTTGGACCGTGCGCACAGATATCCCGACGACCAACGGGTTCCCACAGGTGTGGGACATCGAGAACGCGAACGTGGCC
AAGTTTGCGCCTTTTATGGCAGACCGCGAGCGTGTGGAGATCTTGAAACAGACCTTTGCGTTGTACTTTGGCGAAGTGCAGGGCGCGCCGACGCCAGGAT
GGCCGGGACTTTACCCTGGTC