Description :
From Genome Similarity Track
Location :
Scaffold_114:152425- 156771
Transcript NameFunction/comments
g14425.t1hypothetical protein
g14426.t1hypothetical protein

Sequence
4346 bases(100 bases per row)
AACATGCCCGGCGCCGATCACAGCTCACACAGGAGGAGCGTGCCGAGGAACGGATAGTAAACCAGGAGCAACATGCCCAGCGCCGATCACAGCTTACGCA
GGAGCAGCGTGCCGAAGATCGCATGATAAACCAAGAGCAACACGCGGAGCGCCGATCACAGCTTACGCAGGAGCAGCGTGCTGAAGAACGGATGGCAAAC
CAAGAGCAACACGCGGAGCGCAGATCACAGCTTACGCAGGAGGAACGCGCCGAAGCGCGAAGGGTAAACCAAGAGCAACATGCGGAACGCCGCAGAGAAC
AGACTGAGGAAGAAGCACTGGAGCAACGCGAGAGAGAGCGATTTCGGCGTAGATCGGCTCGACGTGGAGAGGCGTTGGCAAACCACGACGATTTTGACGT
GGCCTACGTCCAGGGTCCAGACGTTGTGAATGGGCGCCATCGGCTTCCTCCCACCACTGTTTGTGAACATTGTGGCGCTTGGAAGTGGCCTGGCGAATCA
AAAATGAGCTGCTGTCTGGAAGACAAGGTTCGTCTTCCCCCTTTACGGTCTGCACCTCCAAGATTGTTGCAACTGTACCGGGATCCAGCGTTTCGACAGC
ACATACGAGCGTATAACCAAGCTTTTGCGTTCACGTCCATTGGCGCTTCGTGCTCCAACCGATCCTTCCAGGACGTCAACCAGGATGCAAGCGTAGCGGG
ACAGAGGGGCGTGTACACGTACCGCATCCAGGGTGCAATGGGTCACTACTTGGGATCTCTACTCCCCTATATTGATCCCGCCACCGGAGAGCGCACGGAC
CCTAAGTTCGCGCAGATCTATATTGTGGACCCGGACATGCAGCAGCGCGCCCAACGCCGCAGAGGAATTTTTGCTGACTTGGATCCTGTGGCGTTGATGG
ACATTGAGCAAATGATGGAGCAGCACAACCCATTTGCTCAGCAGTTCCTGAGTTTCGGAGAGCAAGTGCGCTCGCGAGACACGAGCGACGTCGTGGATAT
GGTGTTCCGCCTCCACGAAAATATAGCGCATCCTCGGACATACAATTTGCCAACCGTTTCTGAGGTAGGCGCGACGCTCATCGAGGACGGCAACCTGGAT
AGGCCTCGCGATCTACTACTGTATACTCGGGATCACAGGCTTCTGCGACTGTTCGAGACGCGCCCGGAGTATGATCCTCTTCAGTATCCTCTTCTGCTTC
CATATGGGGAGCTGGGTTGGACCTACACGGACACATACGCGAACGGAGTCAGACGTCGCAACAAGAACCAGATGTCCCTTCGCGAACATGTCGCCTTCCG
GTTGCACCAAAAAGTGGGAGATCAGTCTGCTCTTCATCAAGGCGGCCGTCTCTTTCAGCAGTGGTGTGTCGACCAACGCGCTAAATGCGAGCAGGAGCAA
CTTCGCTGGGTGGCCTCACATCAGAAGCAAATTCGCGCCGATCAGTACCGAGGGCTTCAGGACGCACTGCTTAACGAAGGTACAATTCAGCTGGAAGCAG
GCGAAGGGCTACTCTCCGAGTTTGACAGAGGCGATGGTACGTTGGTCCACCCTGATCGAGGCCGTGGTGGTGATACCCATTTTCTTAGCCAAGTGGGACG
CCGCGTTATTCTGCCCTCATCTCATATGGGCAGTCCTCGAGCAATGTACCAGTCCTACCAAGACTCAATGGCCATTGTTAGAGAATTCGGCAAGCCTGAT
GTGTTCATGACAACGACCTGCAGCCCTACATGGGAAGAGATAGTCGAGGCCCTTGGGTCCGATCAACAAAACGCTCAGGACCGCCCCGATATTGTAGCCC
GTGTCTGGCAGCAAAAACTGCAAGCTCAGCTTAAAGACCTGAGCGAAGGAGTGCTGGGCCGTATGGAAGCGCGGATTTACGTGGTCGAGTTTCAAAAGAG
AGGGCTCCCTCACGCGCACATCTTGATCATTTTGGCTGAAGAGGACAAGCCACGTACTCGCCAAATCGTAGATCGTATGGTGTCTGCAGAGCTTCCTGAC
AGAGAAAAGTTCCCGCAGCTATTCGAGACAATCATGACATGCATGCTGCATGGACCCTGTGGAGCGGCAAACCCGTCATGCGCTTGCATGAAGGACGGGA
AGTGTACGAAAGGATATCCGAAACCTTTTGCAGAGGCGACAAGGACCAATGTGAACGGCTATCCGGTCTACAGACGGCGTCGACGAGCTGAAGGCGTCCT
GGTATGGAAGGGCAGGGAGTACGACAACGCCACTATTAACCAGTGGGTTGTTCCGTACAACCCGTACTTATCCCAAAAGTACAATTGCCACATCAACGTC
GAGGTGTGCACGGATATTTCAGCTGTGAAATATCTATACAAGTACGTCTACAAAGGGTCCGATAAAGCTGTGCTAACTGTCGAGGCAGTTCGCGCGGGTG
GAGAGCTCCCTCGGCAAGAGCCAAACGAGATTCTGCGCTTCCTCACGGCCAGGTACATATCTCCAGTTGAAGCCTGTATCCGCTTACTCGACTTCTTGAT
CCAAGGAAAGACACACGCAGTCACTCAGCTTACCGTTCACGTCGAAGATGCCCAAACCGTGTTCTTCAGAGCGACGGAAGACCCGGAGCGTGTCCTGGGT
CGTGGGAATCACACCATGTTGACCCGCTTCTTCGAATTGTGTGCGAGCGACGAACCCGAGAACCAGATCGCGAAGACAATGCTGTACCAGGATATACCCA
AGGAATTCCGCTGGATGGGAAACACGAAGTGCTGGGTTCGACGTAAAAGGTACCAGGCTGCAATTGGTCGGATGGTGCATGTTTCACCGCGTGATATGGA
GCGCTTCTATTTACGCCTGCTACTATGCCATCGCCGAGGACCGAGGTCTTTCGAAGACCTGCGGACAGTTGATGGTGTGCTGTGTCCCACGTATCGAGAC
GCGGCTGAACATGCCGGCTATCTGGAGAACGACAGCGAATGGGTTTTGTGTTTGTCGGAGGCTGCCGAGTTCCAGATGCCGTACCAGCTGCGCCAGCTCT
TTGCAACAATCTTGGTCTACTCGGCGCCTACGGATGTTCGGGGTCTTTGGGACCAATTCTTCAAAGACCTTTCGCTTGACTATGCGTACAGGAACCGAGA
GATGTTGGACCCTTTTAAAACGTCTGTTGTGACGTTCGACACACTGAAGAGTATCCAAGACTTGCTCAGTGTCAGTGGGTACTCCGTCCAAGACTTTGAT
CTCCCTCGGCTGAGCGAGTTCCCTCGCCTGGTGCTTGAGTCTGTTCTGCAAAACAATCTCATCCGACGAGAGCTAACGGGATATGACGCGTCTGTTCTTG
AACAAATTGTGAGCGAGGAGGACCACCTAAACGAGGAGCAGCGCTTGACCTATGATCAGATCACCCAAGCTGTCGAGGACCCACAGGAAGGCAGGAAGCT
ATTCTTCGTTGATGGACCAGGCGGTACCGGGAAGTCGACACTGCTTCGGAACATACTGGCCAAGGTTCGTCTATCCGGGAAAATTGCAATCGCGGTCGCT
TCCAGTGGGATTGCTTCTCTGCTGCTTATGGGAGGTCGGACAGCGCATTCTACCTTCAAAATCCCCTTGAAGATAGACGGCGAATCTACTTGCAACATCA
ACAAGCGATCCCAGGTCACGGAATTGATGAGGAAAGCAAGTTTGATAGTTTGGGACGAGGCACCCATGGCGCATCGGCACGCGTTTGAGGCAGTGGACAG
AACGCTTCGTGACGTTTTGGATAACGAGGCAGAACCTTTCGGTGGGAAAGTCGTTGTGCTTTCGGGAGATTTCAGGCAAATTCTCCCGGTGGTGAAGGGC
GGCTCGGCGACATAGACAATCGACGCATGCCTGAAGTCATCCGAACTGTGGCCACTTTTCCAGAAGGTGCGTCTGACAGAGAACATGCGTGTTCGCACGG
CTGCCACCTCCGATAGTGCTGCAGAAATGGCTGCGTTTTCCGAGTACCTGCTGGAGGTTGGAGAGGGGAGACACGAGGTACACAATGATCTGGGAAATGA
CTACATTAAGATTCCACGTGACATGCTCATCGACAACCCGCCGGTGATCCAGATGAGGACGAGGAGATCCGTCCGGGAGCTATTCCGCGAGGTATGCGGC
GCATGATCGACGAGATGTACGCCGACATCAACAATTCGGAAGTCGCAACGGACGAGTACTTTGCGAGTCGCACCATCCTCACCACCACGAACGCGATAGT
CCATCGTATCAACGAAGCCGTAGCGGATCGCATGACTGGGCCAGCTCGAGAATATGTGTCCACGGACTCAGTGGAGGATGACGAGGACGGGAACTTATTC
GAGCAGGAGGTGCTCAACTCCCTGAACATCAGTGGTATCCCACCCC