Description :
From Genome Similarity Track
Location :
contig_88:152375- 153579
Transcript NameFunction/comments
g10608.t1hypothetical protein PHYSODRAFT_314541

Sequence
1204 bases(100 bases per row)
TCCTCCACTACGGAGCCTTCGTTTTGCGTGAATGCTCGTCTGCGTGGTCGTACCTGACGCAGCCTGACTTGTGCTGTTGATGTGTAAGCAGACCCAACGG
CTGTGGTCTGACACCCGATGCCGTCAGACCAATACGCGGTTGTGCATTCAGCAAACGTGCACAATGGCAATTTAGTTTAGCTGGTTCACTTCAACGCCCA
AATCTTTGCGAGTCTTGTCACGAGTTGTGCACAGCATTAACTAAAACTACATGTTGTGGCGCTTATTCACTTTTCTTCAGCTCTTCGCCTCAGCTTTTGC
GTCCTCGGTGCGAAATCGAGAACCTGCACCCCAGGTATATGCACGACTTGAGCACTGACGTCACTCCTTCCCGTGTGATCATCTTGTCGTGCTCGTCCAG
CAGCATGTACGGCTTGAGCGATGGGTGTGTCTTCGCGACCTCGTCGAATTCCGGACCGAGCCGCCAGCCGTTGGCCGCGTACTCGGTCGCCCACACCTCG
TGCGAGTTTTCGGCAAGCAGATCGACGAGCATCATGACATCCCACGATAGCTGAACATGGTCGACGGGGAACGGGACGTCTCGCGTTTTCAGCTTGGGCG
GGCGACGGTAAACGTGGACTCCGAGAGCAACCACACACTTGATGATTTCGTCGACGGAGCACAAGTTGCGACCTCGGGCGGTGTCGTCGAGCGCACGCAT
CGGCAGCATGCAAGGGTGCACCAAACGCGTGTCATCTCGCACGTCGCCGTACTTCCAGCCAGCTAATGACTTCCCGCGGCACCAGTCATAGTGCATCTGC
GACGCGACAAGCTCCCGGTGTGGCTGGAACCATCGAGGAAGTGCCGTCTCCGTCGTAACGATTGGATTCGGAAGGTAGTCCTCACCAGTCTGAGGCAATG
AGGTGTCTGCTGAACCCTCTAGCGCCAGGTCACCTAACGTATCATGGCGAATCGCGGCTGCCATTTTCAGGAACCGGTTCTGGTGCACGGAGACGGCACT
TCCCAGCTCGTGATCTTCGATGGAGAGCGTCGGAGCTTGCTTCAGTGCTTCGACCTGCTTGCGTAGGCTCTTCGAGTCGATGTTGCGGTGCGTCCAGCGG
TGCTGCAAAATGCCTTCCAATGTGATGCGCTTCTCCGGGTCCTTCTCTAAAATCTTCCCTAACAAGTCCTTTGCGTCAGCGTCTGCGCATGAGGCAGGGT
ACTC