Description :
From Genome Similarity Track
Location :
contig_12:152344- 157416
Transcript NameFunction/comments
g3155.t1hypothetical protein
g3156.t1hypothetical protein
g3157.t1Serine carboxypeptidase 26

Sequence
5072 bases(100 bases per row)
CGAGAGCTTGACAGTCTCCAGCTCTGCATTCGCAGACCGAGAGCCGCCAGCAGAGTCGAAACCAAAGCCACGGTCTTGGACATGAACGAGTAAACCATCG
GGACAGCGTCGAGGTTGAGCTTGTGCCCTGCGCGATTAATTGCTTAGTGGGGCAGTGTTATTAGAGACAGCAGCCATTTGCTTACGCTGTTGCGAACAGA
TCGCGGGATATCCATGGGGTAAGTTACCCGATTGTCGATCGCTCGACTGGACTATCGACGAGCTTACGGCCGGCAAGATCACATGCTTAACAGCCAGAAG
AAGTCTGCTCAGAGATGAAACAAACCTTCAACTTGTTTAACGTTTAATGAACTGTATCAAAGGTGTAGTAAACTCAGAAGCTAATTTGCTGGCATGTCGA
TCTTCTCACTTGGTCATTCGGACGATCCTCTGCCGGTAGAAGTTGTCATGCAACGTGGCTGGACGTCCTCCATTCTTGTGAAACAGCATCTCCTCCTTAT
GCAGTCGGTCCATCTTGTCCAGATACACGGTCGCAGCATGGCACACCTTCCTCAACTCACTGCTGTCCAGCTGCTCGGCCACTCGCTCCTCTCGACGCAG
GATCCTCCTCGCGCGCTTGAACTTGCCCAGCTGCAGGGCGTTGTACATCAAGTTCACTCTGCACTTGCTCTCCAGCACGGGGTCCTGGAGCCCCATGGAG
ATGCCGATCTGCAGCTTGGCCAGCAGCGTCGACTGGTTCAAATGGCGACACAGGAAGTGGCCGCCTCCTAGCGTCGAAATGTACGCGTTGGCCGTGACCA
GCGCCACCACCGCATTGACCAGCTTGACGGCGCGCCTCGCTGATGCCATGTACAATGGCAGGAGCTGCGTGGGTCTGTACGTAACCAGCACCAGCACTCG
ACGAGTGTCTTGAGGGCTCTCCGCCACGAGGTAGCGAGCGGTGGCGTCCTCCATAATGTTCTTCTGGTTGGTCTTCAAACTGATTCTCTCCAACAGCCTC
GAAAGCTGCTGTGTCTCCTCCGGATACATGCAGAGCCCTCATCCGATAGTAGAAAGGTCACAAACTGGAAAACCTCCGCGTCTGCGATGGCTACAGAGCC
GCAACACACGGAAATTATGGGAGAAGTGCAACATTTGTGTGTGAAGCCACGGTACGTTTCAATGCGCGCAAGGCTCTGCGCTCCTGCAGCGGCGCCTCGA
AGGCCACGACGCTCAGGACACCCAGTGCAACACCCGTCATCTTCCGAAATGGATGCATGTGATCGGATTGGATGTAAAGAAGTTCATTAATAGCCAATCG
GAGACAGATGCATCTTGAAGCGAGCGTTTGGCTCGGATATCCTCATCGGCCATGTCGCTCTTCCAGGTGCGCGAGTGGTGGGCCGCCAAGGGCGAGAATG
ACGAGGAGTATACTTCAGGGGCGCTGGTCGTGGGCAACGTGGACAACGACGCGTCTGGCCATGGTAAAGTGCGAATTGTTGCAACTGTGGGGGTCTCGTC
CGCTGACTGCGACACACATTCCTACAGCGAAGATCGTGACGGGCAGTTTGAACGGCGTGTGCGCGTATATTGCCCCACGCAGAGCGACTTCCGCATCGAG
CATTTTGCTCGAAGAGAACCTCCGCCGCCCGATTCTGCAGTTGGCGCTGGGCTACTTTATCCCGTGAGTCTGGTGGCCTCACGTGCAGTGGATGAAACAG
TATAGCTGATTTTGTGTTCTGTACGGCAGGAACCAACGCATCTTGGCGCTGGCCATTCTACAGCCGAGGAGGATTGGGGTCTATGTGGTGGAAGGCATGG
GCGGGACGGGGATGGCGGCGAGTTACTTCAAGATCACACTACGATACGAACACCTGTTGGGGATCGATGGCGAGCATTTTACAGCGTACAACTTCATTTA
CGGGCCGTTTGGGTCAGCCAGCTCGAGCTCTGGCGGAGCAGCTCCTGCACGCTTGGAGAAAGATCATTTGTGCGTGCAGTCGCTGGATGGGCGGCTTCAG
TTTTTCGAGCAGGACCGATTCGCATTCCTGCAGCCACTCAACAACAATTTCTTGCCGGGCGCGATATGCTATGCGGCTGGCATGGACGCAGTTATAGCAG
CCACGTCAGACTTGCAACTTGAGTGCTACCGTTACCAAGTCTTGGCCTCTGCCTCGCTAAAGAAGAAGAAGAACGCGCTGGATAAAGAAGACCGACAAGG
GGATGCCTCGTCGGCGTCCGTACACTGCGATTGGAAGATTAATATTGGTGAAATCATTGTGGATGTTCGAGTGCGCGAACTTCATACCAGGACTCGGCAA
CCAGCTTTGACATTCTGGTTCTTGGAGAATTCACGCTTTTTGGTATCAAACCCCAAGGAGAGGTATATCTGCAGAAGCGACTAGGCTTTCACCCATCGGC
ATTTTGTCCGTTCCAGCGCTGGGCATCACCTACCGAGCGGGGTACACCAAACACCACTGCGCTGGAAAACCTGCTCGTTGCCAGCGACACGAAACTGTGG
AGTGTCTTCAAGGACAAAACACTCATTTGGTCTGCTTGTTCCTCGGTGGTTCCCGTGGCCCTCCAGGTCCGAATTTGGCGGCATAGATGGAATGATCGTG
AGCCTCGACTCGGATGGAGCGCTTTCTGTGAATTATATGGGTACAGATCCGCCGTCCTCCGCTGTTGTTGCACCAGACACAAAGGAAATCAACTATGAAG
AGATGGATGGACACAGCTACTGAATGTCATTCGACGTGCACAAGGCGAGCGACGGACGGAGCCAAAGGATCTCCGAGCCCAGGTGCCTGCAATACTGGAT
GCACTACCGGATCGGAGCGACGAGTTTAGTCGTGGAGGCGGGAGCCCCGTACATGATGGCAAGAATACACAGCTGACGATGCGCGTGTACGTCACGTACA
CGGGTGCCAACCGTGTGTCCAATGTGACGCTATCGGTGTTGACTCCCGAAAATGTGGCGGCTAGTGACTCCTCCTTCGTGATCGGGAGTATCGATGGCAA
GGCATCTACGCCGCTCATCATTCCGGTTGTATTGCGCCCAAGTGCTAATGCCAACCTCGTTATCCGTTACCATTTCAGCATCCTACACACTCGAGACAGG
GCAGCCTCGTGTCTCAGTGTGTTGTGAAGTTGCCCATGTGCATGGCGTGCGCCTCGTGCCTCCCGTCAAGTCGAGCACCTTTAAATTCACCCTCGAGACT
AATCAAGAGCCGCTGGAACTTGCTAGCCTGTTCGAAGACATGCTTCACCAGCCAAGTTGCACGCCTGAGTGGGCAAAACAAGTGGTGGGAGGATCCGGTA
CAAACGTGCTGAGCTTCCAGTACTACAATGGTGTCGAAGCCACGATTCTCGTGTCGAAGAACGCTGGACGGTACCGCATCCAGTCGAACGAGCTCGAGGC
GCTCTGGATGGTGTCACAAGAGCTCGTTGTACGACTCCGTGCATACTTTGACGGTCGGGAGCAGAATGCGGAGGCCAAGAGCGGCGGAGGTGGATCCTCC
TCGTCGGTGTTGGAGGTGTTTTACCAGGAGCCCCTCCCGCTCGCAGATTTCTTCGGCGCGATTGACGCGCACTTTGCTCTGCGAAAGGAAAAACTTGAGC
TCGCGGCGCAGCTGAACGACCGAGCCACCAGTTCCGCGTCATCCAGAAGCGGTTGTTGGTGCGCTACAAGGATCGCAGCCCCGCCGCTGTGAATTATCTG
GACGTGCTGCTGCACGGCACGTATGACCAACTCATTTCGTTGTCGCACGCCATGGAGGCTGTGGAAGTCAAGCTCAAGCGCGCGGCGAACCGATTGTCGT
GCTGCGTGTCGCTCATACTGATGCTCATTCAATTCCGGTTCCACCTGAGCGATGAAGACGCGCAGCTGCTCGAGGCATATCTGTCGCCCGTCGTGAACGA
GTCTGCCGACAGCGGTGCCGTGGAGCAAGGCTGGGAGGAGCGGACCGACTGTGCCATGACGGAGCTGCTGCGCACAGTGCTGGCCAAGCAGCCCCAGAAC
AAGGACGGCGCGTCTGCGACTCCTGCGCTCGCGACGAGCGAGCTGCAGATGCAGGAGGACACCAAGCGGCTGAAGAAGCACATTACAATCGTGTGCGACC
GTCTCGGCAAGGGCGCGTCTCTGGTCTCTGGCAGCAACACACCGCTCCCGGCAGCGCAGCACCACCTCCCGGCGAATCGAAGGGAGACTAGCGACAGAAA
ATGCTCGCACAACATCATTTAGCTTTCGTCGTGTGGAGACTGCATCCTAAAACTTGAGGACGATTTCAATTTGACTTGCCAGTTGTATTGGTCAAGTTGA
AGTGGTCGTGATTGCCAATATCATCTCGGATTGGTAGAAACAGATAGAAATCAGATGCTGTAAATTCTTCCATTGGCTGAAATGACTGCGTAGAGTGTGT
ACTTTTCGTAACTGCCGTCTGCTCCAAACATCCTCGATGATCTGATGCTCTGCCTTCTTCCAGCCTCACCTTCTTGTCTCTCTCTTGCAATGATTGCCAT
CAGTTGCTCGTCTGCCTCACTTGCAACTTTCCTGTCATTGACGCAATTCAAGAGACCAAGATGAAGGTGGCACTGCAACTGCTCGCGAGCTTCGCGGCGC
TGCTGGCCGTGACTTCAGGCGCCCGCAACGACGACGCACTGGTCAAGAATCTGCCGGGTTTGACCCGAAAGCTGCCGTTCAAGCATTACGCCGGCCACTG
GAGCTCGAGGAGAAGGAGAAGCTCTTTTACTGGTACACGGAGAGTCAGAACGACCCGGAGAACGACCCGATCGTGCTGTGGCTCAACGGCGGCCCGGGCT
GCTCGTCGCTCGGCGGCCTCTTCACGGAGAACGGCCCGTTCGTCGTGCGTGACGACCTCTCCATCAAGGTGAACCGCTACTCGTGGAACCGCAAGGTGAA
CATGTGTGGCTCGAGTCTCCCGCAGGTGTGGGCTTCAGCGGACCAGTGGAGGGTCCCAACTACTACAATGATGACGTCGTGGCGGCCAAGACGCGCGAGT
TCCTCGCCCTTTTCTTCAGAAAATTCAGTGAGCTCAGAACCGCGACTTTTACATCACGGGTGAAAGTTACGC