Description :
From Genome Similarity Track
Location :
Scaffold_643:1523- 9672
Transcript NameFunction/comments
Phyta_totarag9884hypothetical protein PHYSODRAFT_343761
Phyta_totarag9885hypothetical protein PHYSODRAFT_248383
Phyta_totarag9886ferric reductase, putative

Sequence
8149 bases(100 bases per row)
AGTGAGCTACAATTAGCCACCGTCGGAGAGCATCAGTCTGATTGGATTTAGTGTTCGTGGTCTATTGTTGCCTGTCACTGCTAAGAAGGCTCTGACCACA
CCGGCAGTCGTGAAAATCAGAGCCAACCGCCGAGACTTCAAGTGACTGGAAGCGATGGAGGTGGCCGTTGTCTCGGAAGCTGTGGTATCGGAGGCGCTGC
ACCAACTGTACAGTCCGCTGAGCTCACCGCGCgtgcgacgacgtgctgattcgttgctgcagcagttccagcgcTCGCCCGAAGCTGCGCAGACGGCGTT
GGCCGTACTGCAAGCGCCAATTGTTGACACGGGAAATGTCGAGCACAATGCATTGCTCCGGGCCAAGCGTGCGTTTTCGGCGTCGACGGTCTACTTTACA
GTGGCCACGTACATCCGCAAGTACAAGATGGACGACTCGGCCAACTGGACGCCAGAGGATCGAGCacagcacgagcttcttgtgAAGGACTTCGGCCTGA
TGGCTCAGGAGGTCTGGAATGTGTTGACTGGGCCGAATGGCACCCAGGAGGAGCTGAATGTGCAGACTCACCTGGCACTAACAATTGCAGTCATCTTGCT
GCGCTTTCACGAGCCGCAGGGTGATACCAGTGTGGTTGGTGCGGTGGAATGGCTTGTTCAAAACCAACAGCACCCGGTTAGTGATGGTGTAACAGCTACT
TTGACCAATTTCGCCGTGCTGCTTACACTGAAGGTTATTCCGGAAGAAGTAGACAATAAACGCGTCAAATTCTCCAAGGTCAAACGCGTGCAGTGCGAGG
ACATGGTGCAGCAGTGCGCGGCGCATGTGGTTCGTACTGTTCTCCCGTCGATTGCTGCCACTATTGATGCAAGTGAGGAGCAAGTACAATTACGTGGTCT
ATTGTTGCAAGCTTTTGCGAGCTGGGTGGAACATGGCTCAGTACCGCCGACAGTTCTCATTGAGAGCGGGTTGTTAGACCGATCTTTTCGTGATACGTTG
GTGCCAGCCTCGTCAGTGTACGCGTTGCAGGTTGTACGCGAAGTGGTGCGAGCCTGCCGCCACGATGAACATGTACAGCTGATGGAGCTTGTAATGCACA
ATTTTGTGGTGCTAGGAAAGCACGTCCAAGAGCGGATAGCAGCATCCGAGAAAAGCGTGGATTTTTGCGTTGCCGACTGCGCTAGAGCGATATCAGAATG
TGGGCAAGCCTTTATCGTGTATTTTGTGGACTACACGCTGGATATGCGACCTGGGTCTTTGGTGTATGAATTCCTGGACACGATTCTattcttcacgtcg
ctgaATAACCTCGACATCTCTAACGAAACGATGGATTTCTGGATTGATTTCCGCGCATATATATCTGGcaagcacgagcagcgcatGTACGTATTTGAAT
CGTTCATCTCACGTTTGTTGATCATTCTGATTGAACGGACCCAATATCCCGAGGGGTTTGAAGCCTTCCCGGAAGCTGCCAAGGAGCGCTTCTTCCTGTA
CCGAAGCGAAGTTCGCAACGTGTTCCGTGCACTTGCTACAGTCACAATAGCCAGCGAAGACAAGTTCATAGTTGATTCTATTCATGCGATCTTCCAACAG
TATGAAGCCGCCGATTCAGGATCCCCTTTGCCGCCGAATGTACGTGTGCCGCCGCGACTAGTCAAGAATTGTGTCCGCCGTGTTACATGTAGAAGAACTA
ACACTTTTGTAAAACTTGTGTGTTGTGATAATGTTTAGTGGTGGCAACGCACAGAAGTATATGTACACGCTCTTAGTGCGTTATCAAAATCGATTCGCGA
GGAAGACACATCTCTCGTTCCAAGGCTGTTTGAATACTTGTCGCGAAAGGAGCCCTCTCACCGCGCACTCTCGCGCACAGTTACTATTTTCCTTGGTGTG
GCCGGTCATTGGTTTGCAAGACACCCCGAGCATTTGTCGACCTACGCGTTCAAAATTATTTCCAACGGCTTCGAGCTCTCCCAGGATGATCCTGGATTCC
CGTTCAGTCAGCACGGCCTAGAAGATCACGTAGGTGCTGTGGCACTGCGTAAGCTGACGCTTCGCTGTGGCTCACACTTCTTCAATCCACTATGGATGGA
TGCACTGGTGAACTTGTACTGCGCGGCAGTAGGCGGAGCATTGGGGCAATGCTTGACGGGAAATAGTGCGAAGCTTGTCGTGGACTCGATCTGCCATGTC
CTCACCACTGTATCGTACAAGGATGCCCTTCCAGTAGTGGAGGAACTCGGTGCCATCATGTTTGCAGACCTTGCATCGCGTTACAGTCAGCTAAacgcgg
acgacgaaggcTCAGTAGAATTCCTGTGCGAGATGTTCAATCACCTTCTCGTGTTAGCCACAAGGGTCCCTATGCAGATGGACCAAGAGACCCCGCATCC
AGTTCTCTGTGTGCTGCAAACACAGTgggaggtgctggagaccATTTTGCGCGTGTACGGCTGCTGTGAAGAAGTGGTTGAGCGATTCTGTGCACTTCTG
GTAGGCGTTTTTGAATCTTTGCGGTTCCAAGCGTTGGAGCTGGCATCTGCAATCATGCCAGCGTTGCTGGAACAATTTTCGCGGAGTCATGACGGTAGTT
ATCTAGGTGTGATCAGAAGTATCATTGGTtgcgctggcgacgacgagtctACAGCAGTTAGCTTAACTCGCGTGATGGTTATCGTCAGTGAGAGCTCAAT
GAGCAAGATCGCGGCAGACGGCAGTGTTGATGAACACCCGGGGCTTACCATTTCGCTGTTTTCTTTGGTGGCAACCTGCGGCACCCACCACCCGTCGATT
TTAGTCCAGTCAAACCAGTTGGAGGGTGTGCTGGCGCTAACATTGCATGCCTTTAAGTCGCAGAATCCTGAAGTCGGAGCTGCGACTCTTGACTTCCTGC
TTGAGTTGGGCTCACTGTACGGCCAGATCCTACGTACTCCAGAAAGCTTGCTCCAAGGTCCTGAATTTGCAggcaagatgctgcttcaccagcaaATCCA
GACGTTGTTCTTTGAAAAGGACGTGCAGTACCACGTACTCTTCGCTTTGTTCAATGCCGCAGCAGGGGGTATGCCACCTAacttgatggagaagatAGCG
GAGGTCGTTCGGTCTTGCTGGATCTACTTCGGACGACAGCGGAGTGAAGAGCTCATCCGTCGGCTTTTGTCAGACAACAACTTTTTGGGCTCGCAGGTCA
ACGAGCGCGCGCGAACCGAGTTCCTCAACTACATTTCTACCCCGACTTGCGCGGAAAACTCGCGCAAATTTAAGCGCGTTCTGAACGCGTTTTGcgacca
cttcaagcgcAACCTTACAGGTAGTGCGAACGGGAGTGTGCTGCCTTCGTAAGAGGTTGCTGTTTTGGCTATCGGAACTGCATCAGGATGATACGAAATT
GGGGAGCTGAAATCGAAAGCCGATCAGCAGCCAGATATTTTAAGGATACGATGCAAAAAATCTCCTTACGCTTCCTTGTCGGCCAAATTGCTTATTTCTA
CTGAAACGGGTTGCCAGCGTCCTTCCAGGACGTCGTGTTGTTCTCTGTGGTGGCAGTGATCAAATGTCCACTCGGAGGGCGAGCAGCGTAAGGAGCGTTC
GACCATTCCAAAATCTTCTGGGCAATATCGTCCGCCTGTGTTTCAATTCATAAAATTACATATGCGACCATGATCGTTCCGGCAAATAACCACCTCGTCG
TACCTTGGTCCAGCTGGAAAAGTCGGCGTCGGCCATGAACTTGCGGTTCATCGGCGTGTCAATCGTCGTCGGTAGCACGCCGAGCACCGACGAACCCTCA
GGCAGCTCAGTCCTGCAATAAGCAACACATACAAAAATACCATCAGTGCACAAATAATGTGTGCGATCACAACAAGCTGCTTCTAAAACGCCTTACACAG
CACTGGCGATCAAGTGATGAGTGGCCGCCTTGCTAGCTCCATAGGACACCATGCCAGGGGTAGCCTTGAGCGCGGCAGTTGCACCCGTCAGAACGAGCAA
ACCTCCAGGCACCAGTAAGTGACTCGCCAAGTACGTCGCTACAGAAACAACATCACTCTGTGAGCAACTCCAACGTCAACTAATCGCACCCTGTCGCACC
CACCCACCCAGGAACGCCGACTCGAGGTTCTTGGCGTGCATGTCCCCCAAATTGACGAGCGAGTCTGCGTCGCGGATGCTACCGCCTGCCCATCCGCCAG
CAGTGCACACCACAGTGTTCACCTTACCATATCTGTCCACCCCTCACAAGTCAGCGCCCTAATACAATACCCAAGACACAATATAGTAAACAGACCTACC
TGCTGGAGATTTCCTGTAGCGCCTGCTCCGCCTGcttgagcgagttgctcTCGGGCAGAAGCACGTTGTTGTCGGCGTCCTCGTTCGCCGAGAACCCCAC
AGAAGTGACGCCCCAGGACGCACGCGCGAAGTAGTTCACCACGCCGCGACCCAGCGCGCCGGCGCCGCCAacgacaagcagcttcttggacaTTGTGCAG
AGCAGTCAAATGAGGGCCCTGAACTACAAGTTGAGGTACAGTCACATCCCTCTATAGTGACAAGCGATTAACAAATTGATAGAGGTTTTGTAAATGAAAA
CAATTTGCACTACGTTCTACGAAGTCTAGGACATTTGAATACAAGCTGAGCTGCCTCTACTCAGCAGCGAACACACATGTACTGCAACGACGTATATCTG
TTTAATCTATGAGAACTTCTCCGAGTGGAAGTCGAAGATGGTTCCGTTGGCGTCCGAAGACGAATACCGCTTGCACGTGTTGTCCAGGATTTCCTCCAGC
GCGTGCGGGCCGCAGTAGAACACACCGACTTCCTCGCCAGGGTGGTTGGCCTTGGCCTCAGAAAAAACCTTGTCCCAGTCTGGACGGCCGAAgtgcgtga
gctgcttcGTGTTCAGACCAGATACGAAATCCTTGCCGGTCTCTTCGTGCACGAACTCCTGGAACATCTTGAGCTGTGACGTGTTCTCGCTGCCCTTCAA
CGTACTCAAGTACTGGTGGGTCTCGATCACGTTGTCGCGGTCCATCTCGGCGATCTGGTTCATCGTCTCTTCAAACCAGCTCAGCGATTCCTGTCCACGG
GTAACCCAGTGGAAGTACAGCTTCTGGATCTTGAACGAGCCCGGATGCCGGACGTGGCTGCAGTTCGGGCAGCGGTTGTCCTCCCACAAGTGCACCACGT
CCTTCAGGATCGAGGCGAACGGGGTAACACCGATACCACCGCCGACACAGATGACAGTCTTGTAGCGGTGGTAATCCTGGGTCGGAGCACCAACCGGGCC
ATCCAGGTAGATGTCCGGGTACAACACCTTGCGTTCATGGCAGTCCGAGATGACGCGGCCCAAGGCTTGAGTCCAGTCACCGCAAACACGGATGTGGACA
CTAATGTAGTTGTCTCCAGGAGCCGACGAAATCGTGAATGGGTGCCACTCATGAGAAGAGATCAGCGGGCAGTTGACGAACATGTACATGCCGGGACGGT
ACACAAAACGACGAGGCTTCTCTATGAACAAAGCAACAGTGCCATCCAGCTCCATTGCCTCCATGATACGCACAGGCGCAGCGAACATCTTAGCGTAGCG
GAAACGACGCTCGATCAGGTAGATCAGGAACGGGGGAGTAATCCAGATGTAGGAAGAGCTGCGAGCGAgccatgatgcagcaccGTGGAACGACAACACA
ATCAGGAAGGGTCCGAAGAGCATGTGCGAGTACCAGAAGAGGTTGAACTTGCCCTGACGGAACTTGGGGGTTGCGGCCAACGGGAACGAGATGCAGGTGA
TCACCAGAAGAATCGCACCAGTCCACACTGGAAGCGACTGAAGCATGGTAGTGAACGGAGGTCGCTCACCATTAACGAATGAAGACACGTGACGCGTGAC
GAAAATGGAGCGTTTGATCTCCTCTGGCGTCGCGATTAGGTACAAGTAGACCTCGTTGAAAATATGGGCGACCGTGTGAATCAGGCCGGCAGTCAGCAGC
ACACTACCCGAAATCTTGTGGAATGCGATACTGTCATCAAAGGGGATGTAGCGCCACAAGAACCGGCTGCGCTTCATCACTTGTGTGATGGAACGGCACA
TGGGCAGGAGGACGAAAACGCAGTTGACCATCGCAACTTGAGCATTGGCACGGGCGATCCGAAGACCCCAACCGATGGCGGGGTCTACTTCGTACGCGAA
CCACTTGAGCCAAAAGGCAGCGTTATTAACAAGAACGTACACCAGGAGCCACCAGATGCGGAGCTTGTTGGCTCTGTACCAAGCGCCAAACTTACTCTTC
GGGCGGATAGGAGCCGTGTACATAGGTTCTGGCTTTCGGAGGTTGTACGAGTCGTTGATGTAAGGGGCGAACACTCCGCAGAACTGCTCGTACGTCATGG
ACCCGTCCTTTACTTGTGCCTTGCGGAACATTAGGTTGGCCACCGTCTTGAAGTCCGTGCCAACGACGTCAAGGTGGGCCGCCGAGAAATTCGACTCCAG
TAGCTGGACGATCTGGTCTTCGATCACGTACCCTGAATTGTCTGGGTCGAGCGTCTCAAAGATGAAACGCAGTTTCTCCTCGGCGCCTACTTCGAGGTCC
ATAACCGCGTCGATCAGGATAGCGTTGCCGTCGATCGTGCCGTTGCCAGTGGCATAGCCATCGAATTCAGTGCCGTCAACTTCAAACGCCTGGGAAAAAG
TCTCGCGCTCGATGTAGCCACCCTtgctggtgatgctgctcaTAACATCGCGCAgtgcgtgcagcttctccatgggCGTGTATGCCGGATCGTTGGCGTG
GACGGCGTGCTCGTCCATACTCATGGCCACGCTGTACTTCTGCTCGAAGTTGCAGTCGCCAAGGACCGGAACCGACACGACGTCGGTGCCGGGTTGCGGG
CCGTATCTGGAGCCGCCCATGGACGAcatcatcgacgacatgTTGGATGCCCGAGCTAGACTCTGGCGCACCATGGACGCGCCTAGCATGGCCTGGACGT
TggggcgacggcgctggtTGCCGCGGCTGCTCTTACAGTTAGCGCTCATCTTGGGCGGGCCGCGTCCGATGAAATGTGTGCTGGTGGCGTTCATGTTGAT
GAACTGGCTGCTGTCCATGAAATTGGAAGTCCCCGTGCTATGGAACGAGGACATCATGCCGGGGTGACTGATCATGGGTGGCGGAGGGGGTGGGGGCGGC
GCACGCTTGCCTTTCATGCTGCCCTTCCTGCTGGCTGTCCTGCTGGCTGTCCTCTTGTTTCGGGTGTTGGGCGACGGCGTGGAGATGTCGACAAAAGGCT
GAGTGTTCTGGCCCGGGGtgatcttgagctcgtccgcGGGTGCGCGACTGGGTTGCCGCATCCCAGCGTTCTCCATTTGGCCTCGATTCTGGCGGTCGCG
GTTCATCGTCCACCGAGGCGCCTCGTGTCCCTACGATAGCGAAGAAAGCGAAGTGCGGAGTGCGGTCACGACGATGCGGTTCTGTAGAAGTCCAAGCGCG
ATTGACTGACCCTCGACGCGTTGCCTCTAGAAACGCGCGATCACCTGCGGATCCAGAAATCAGGCAGGTGGCACTGCCGATGGCGTTTCAATCGCAAATG
GCGCAAATGGCGAAGTGTCGGCGCTGGCAACAAGGCGTTGTCATTCGTTCCACCTGGTCGGTGCAGCGCCCGTCCGTGCGCGCGGATGGCACGTCTGTAA
AGTTCAGGCCCACCGAACTTCGACATCTTGGGTTTTGTATGGAATGTTTCTTTTTCGACGCAATTCGCGCTGTCTCTGCAGCGGGCTGGGGGATATCGTT
TTCAGATCCGGCCATATGGCCACGGAGCACAAGCCTGTTGCACATTCCCGCTGACAACAAACGAAAGTCAAGTCCACCAGGCAGCTCTCCTTTGGCCGCT
CGAGTCGATTCTTGAGGTTCAGCTCAAGAATCCGGCCTCGAACTCACTTGCTTGCtatccagcaccaccaaaaGCGCTGGAAAGCAACGCCATGCCAGTT
AACTCAAGTTTCATTCGTCTGGCCACAACAGATTCACTATCACTACGCCGCGCAGCGATGGCTTTAAAATGTACGGCCGATCAGATCTCCTGGTTGCAAA
ACCCGAATGCCAATCGTTCGCTTTTTGCATTCCGTTGGTTCGGCGTCGC