Description :
From Genome Similarity Track
Location :
scaffold_1248:1523- 4827
Transcript NameFunction/comments
g11213.t1hypothetical protein

Sequence
3304 bases(100 bases per row)
GCAACCCAAACCGAGAATGCCAGTCAAGGAACGCTTCAACCGTCACTGCGCTGTCGGCTGTGTCTACCACCACCAGCTCACAGAAATGGGAGGCATGATC
CTTGAGCACCAAGATGTACTTGGAGCCTCCGAAGCCGTCACCCATCGAAAGGAAATCAAAATGTAGCAAACCATTGCGTTCACTGCAATCGAACGTTACA
CCCCAAGGCCTGGGGATGATATTCCCCCCTTTTGAATGCAGGCACAGTCGGCACTGGCGGACAAATGTGGACGCCAAGGAGCGCAAGTTCTTCAGCGCAA
ACAATCGACCAATGTGCTCCACCATGACAGCAATGCCACGGTGTCCTTGGGCACCACAGTGTGCAATGATAAACAGTCGCAGGATGAGGTCCTTCGCCTC
CACACGAATCCAGACACGGTTGTTGAGCGCGAGGACACCAGCACTGGTGCGCTCGACTCCTCGGGGTGGCTCAAAGCGAGATTGTACCAGCGAGATCTCG
AATGTTGGCCACGCGAAATTTGCATCATCCAGAGGGCGAAGCATCGAGATGTTCAGCTCCGTCGCCTCCGTAGTTGTCTCTTGTTGAGGTATTGGTGGAG
GTGAGCGAATCCTCCTGATCGTAGCAGTTACTGTAGAGTGGTTTCCAGCCCACCTGCTGATCATGTCGGCCCAAACGTTCTGAGGTCCAGCAATATGTTT
GATCACGTAGTTGTAGTTCATCAATTTCAGAGCCCACCGCAATAACTTTCCTTTCACATGCTTCGTGACGTGCTCATCCGGCGCGAAGACATGGATTAGG
TTACGGTGGTCACAGAACATCCTGAACCCCTGAGGTCGGAGCAGCAAGTAGTCTAGTTTGTCGCAAGCGAGAGCGATCGGAAACGCCTCTTTCTCGATCA
CCGTCCAATTGAGTTGGCTTCCGGTGAAAGTCCCACTCAAACATTCCACAAGCTGGTGCTGCTGGTCCTGGACAGGAACCTTCGCATCGTAGCCCTTAAC
TTGCGTCACAGTGAGCGCCCAACCGACATCCGATGCGTCTGTCAGCAGGCACGTAGTCGCTGAGTCATCAAGGAAAGCAAGAGTAGCCGTCGGCGCTAGC
ATTTCCTTCACGTTGTCGAACGTGGTCTTCTCGTCAGCACTCAGTTCAATCGAAATTCCAGCTGCCGCCCGCTTGGTACGACGGGTTTTCGCCAAAGCTT
CGTCCAGTTTGTGTTGGAGAGGAGAAACTTGACGGGCATAGTCGATCAAGCTTTCGCGCATCCAGTTTATGGCGCACAAAAACTGCTGCAATTCTCCTGC
TGTACTCAGATACGGCATTGCACGAAGTGACTCGATCCGGGCAGGATCATGGCGCACACCGTTAGCGTCGATGATCTTACCACACCACTTCACTTCCTGC
TGGTATAAACTGGACTTCTTGACGCTGAGCTTCAGGCCGAACTCGTTCAGCAGCGAAAAAACAACTCCTTCAGCTTGTCCAAGTACATGTCGATGTCGTC
AGCATAGAGTAACAGGTCGTCAATCCACACCAAAAGGTGTTTGTAAAGCAGCGTGGCAAAACATTTCTCCATAGTCTTCTGGAAGTGAATCGCAGCATCA
CCACAACCTTGAGGGACTCGTCGTGGAGTGTAGATATTCTCATCTGTCATATAAGAGAGCCACTCCTGACAGAACTAAGAGGTAGTTGCCAGAAGCCCTT
AATGAAATCGAAAAGTCCAAAGTGTTGTTTTCCACGTGCATTTTCCATTACCAACGAAAGTATCGGCATCACAGCAGCCATGATGTCAGTCCTTGAATTG
AATTCGCGGTAGTCCGTAGTCTGACGCATGTCCATTAGCTCTTGAGACTTTTTGACGGTAGTACGGGGCTTGCCCATCGACTGGTAGGGTTCTCGTAGAT
CCATCCTAGTTCAACAAGCATAGTGTTAAACTCCCGTAAGAATTGGCGAACATGCGGAGGATATTTGCGGGGCTTACATTTGCATGGTTGGGCCCCCTCC
TTCAAACGCACTTCGAGCGGCGGGACACGGGCAGGCGGATCGTCACGGAGCTCCAAGCGCCACACGTCGTACATGTGCACAATTACTCGCAACTTATCCA
CTTTGTCGGGTGGAGATCCATGCTTGAGGGCTCTTTCGATCAGAACCTCAACGGCAGCACGAACTTCTTCATCACTGGCAACGTGGCTGGGATTTGCAGG
GAGTTCGTCAGCTTCCAGCTCGAAAGGGTCTTCACTCGTTTCATCATCCACGTGAGAGGCAAGTTGCTCCAATTGGCGATCCACATCAATCCCCAAAGTA
GACAACAGATCTCGTCCAATGATAAATTCGTCATCATCCACGTCCATAATGAGGCACGGCACAGCTTCCGCTGGCTGCACCGGTCCAGCAGCCGTGTGGA
TCAGAACATGTAGTAGTGCCTTCTTGGTAGACACAACCGGGTGAGAGCCGTACGCAAGGCTGCGCACCGGTGTATCCAAAGGAATTTCCTGTACCGTTGG
GTCAACTTCAAGCAATGATTTCCACTGCGAACGGCTGATCACTGTGTGATCCGAACCCGTATCTGGGCAGCAAGGTAAATCCAAAATGCCATTAATCGTC
ACGGTACGGGAAGTGGACGGCATCAGCTTTTTTAATCTCTTCGTGCGAGATTTTCGGGCCTTGGACGCCTCTCGAAGCTTTTCTCGCAGCACAACCTTCT
CTACATCAGTCGCCTTCGTGCAGTCACTAAGCCAGTGCATTTCTTGGCACTTCGGGCACGGAGAAGGCGGCTCTTTACGCGAGGCACGTTGCTTGTCTTT
CTTCTTGTCGGTCTTCTTCTCGACCTTTCTCTCAGTAGTTTTCTGCTTGAACTTCTTCCCAGGCTCGGCACTGACAGACTTCTTCGACTGGACAGCAGCT
TTTCCAGTATCTTTCGCAGGTTTGGGCGGCGCGGGTTTATCCCTCGCCATCAACCGCATCCGCTTATTCTGTTGGAAATGGCGTTCATGCTGAACAGCCT
TCTCGTATACCAGCGTGTATAGCTCCTGCATGCTTCTGCCAGCCTCTTTATGGGTCCAACGGACGGCATTCTTAACGTCCTCCTTCAGAACCGGAGGGGC
AAGGCTCGACATGAGACGTTTGCACTTCTCAGCTTCTCCATCAGCGCCGGAAAATACTTCTTCGAGCCCATTTTCTAGGACAATTTCCGCAAAACGCTGG
AAGTAGGAAAGCACGCGAGCATCCACGTCGGTCTCCTTTAGGTCCATCTGTAGCTCCTTCGAGAACAGCGCCTTAATGTCAGGCAGATCATCGTTCTTGA
CCTT