Description :
From Genome Similarity Track
Location :
Scaffold_12:15229- 18597
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_12-fgenesh-gene-0.4Ribonuclease P/MRP 40kDa subunit isoform 1
Pytve_DAOMBR484snap_masked-pve_contig_12-abinit-gene-0.97Tetratricopeptide repeat domain 37

Sequence
3368 bases(100 bases per row)
TGGTGTGGCGCTCGAGCTTCTCGCACCCCAAGTCGCGGCTCGACGAGCTCGTCAGGGGCCACGCGCTGAACCAGCAGCTCGAGGTGGTGCTGCCTGGCGC
CAATGGCCGAGACACCAGCGAGGCGCTGCAGTGGGAGACGAGCTTCTACTACGAGCTGCGCGCGTCGGTGTCGCTGCTTCTGTCGCCCGCCTTCCTGCGC
GATTATGTGACGCAGGGCACCGTGTGCATGATCGCCAAGAACGTGCCGGTGGACTCGCTCGGCTCGGCGATGCTGCTCCCGACCGGCGAGCTGCTGCTGC
TCGTCGACAGCGAAACCTACGAGCAGCTCGGGCTGTTGGGCGTCAAGTACGGAAGCTCCAGCCCCATCAAGAACCGCAGAAGTCATGAAACTCGGCTCGG
ACAGCGATACCTGGTGTCCATCGACCTCAAGGCGTCGGCGTTCACTGCGGATCCGGTGGGAGATGCCGTCCCGCTCCGCGAGCGAGTGGCGTCCATCCTG
CAAAGCAAGCTGGCGCCGATCGACATGTTAGTGTGCGCCGTGAACGACCGCGGTGTGACGCGCACGGTGCTGTTCGGCGACGACGACACGATCGAACGCA
CGCGCAAGGAGGTGAACGGTGGACTCACCCAGATGCGCGACGTGTTCGTGCCGCGGTTCGACGCAGCGTTCGCACAGCTCCGTGCCGCCGACGAGCAGGC
AAAGGATGCGAACCGCTCGTTTGACAATGAAGAGCTCCGGTCGACGCTGGCGGACGCCCACGACTGGCTCGGACTCGTAGCTTGCCGCCTGACGCCGCAA
TTGCAGCGCCAGCTGCTGGATGAGTACGTGTCGCGCTTCTCGGGAGTGCCCGAGACGGTCGAGTGCGACGCCGAAGGCTCCGTGGCGACCGTGCGGTGGC
GTGGGCTCGTCGCCGCCGAGTTCTGCAGCACCATCATCGACAAGGTGAGGCTAGAGGTGAAGACAAAGCGGTTGCCTTGGGCTGCCGTCATGGTCTGGGG
CTTCCCTGACGCGCTCGTCTCGTGGCGGCACGAGGAGCGCGGCAAGAACGACAAGCGACAGCAGGCGAAGGCAAAGGTGGCGAATTGCGAGCACGGGTAT
GTAGAGAACGGTAGCAACAATTACACGCTGCTCGTGCTGCCTGACGATGAGTACTGCCTGCTGCAAACGCTTGGGCCACATGACGCCGCCGCGTGATGAC
CAGAGATACCAATACATCAATAGAGAAACACTAGCAACTGATGATAATTCGACTGAGATCCTGTGTCACAGCTCTCGCATTCATCGGCAAATCAAAAGTG
CTCTACGCAGTCTGACCCACCACCTTCTCGACAAACGCAGCGACGACCGACGCACGACTAGCCACGACGGCGTCATCTCCAGCGAGAGTCACCGCACTCT
TGGCGTGCTTCTTCGCGATCTTTGCCTGGTTCTTCGCCCCATGCACCAATGCCAAGCGAAGGTTCGCCAGGAAACTCGTATTGACCCCAGCGACTTCCAC
ACCAGACTCGGCGACAGCACCGAATTCGGACGCTTGGTTCGTCAAGAGCCTCCATACCTGGATAGCTCCGTCGAGCATGCCCATTTCCTCGTACAACTCG
GCCAGCTCACACAACACCGACGTGAAGAGTGCCGCTCCAATAGCACCGGTGGACTTCGCCAGCTCTCCCAGTTGGTGAAGCGCTTGGTGGTACTCGCTGA
CTGCTTCGTCCGGTTTTGTGATCGACTGCAAGCGCGCAGACAGGAGCTGCAGCTGAGCTTGGAGTGCTGGATCGCCAGCACCAACGCATCCTGTGGACGC
AAGTCGCTGAAGTCCCTGCTCCGCGAATTGCTTGGCTCGAGCTGGATCATCCAGAGCTCGGTAGCAATAGCCCGACAAAAGCTCCAGCTGGGCGAGCAGC
GACTCGGAACGATGCTGGGTCGCACACTGTCGTCCAGTATCCAGCAGTTGCACCAACTGTTCGAGCAGTGTCTGCTGCTTTGTGGTACTCGGCTCGTAAT
TGACGCGTTTGAGGACTCCAAGACCCGCAATGATGTATGCAGACGGATCCCAAGGCTTCATCCGAACCAGCTTCATGGGGCTTGCGAGGTTGTGCTCCAA
GTCGGATGTAAGTAAACTGACCAGTGCTTCCAGGATGGCAGCGTCCTCGGTATCCTCCACGGCAACAGCAGTCGCACTACTGACGAATTTGGCGAGATGG
TGCTCAGCGACTGAGGATTTGGCCTTCAACAGATGCAAGTCCACCATCGCGAGTCCCAGTCGCGTCCACGCAGGGCTCCCGCGGTTTGTAGGCGTCGTGC
CGCCCATATGCTGGAGCAGATAGGCTCCATACGACCCTCTCAGGCGATCGTACAGATCAACCACACGCTGATCCGAACCTGATCCGAGGTCGACAACGAT
CCGAGCGAAAGCTGCTGCCGCGAGGCTCGCTGGACTGTCAGGATCGATGGATTCTTCCTGCGCAAGACACGCCATGGAAAGAGCAACTGCGCCAGCAGCG
CTTGCAGCGCTAGACGTCGGATGGTCGTCAAGATCCAGCAGCTGCTGTAGACTATCAATGCACTTCTCCCAGTTCTTGGCCTCGCGATGCGTGTGCGCTT
GGAGAACAGCAGTCAGGACGAGCGCACTCGTCTTGTCTGGCGACACCGCTTGCATCATGCTGATAAGCTCGTTGATCTTGTCAGCTATAGAGTCACCTCG
CGCGGTGGCCGCACCAATGTCCGCCACCAGCTTGTTCCACTCCAACTGACGGGTGATCGCGGTATCAGTGTTGCCCTCTGACTTGCACAATGCCAATGAG
CGAGCATACGAAGCGGAGGCTTCAGCGTACAACCCCACTCGCTGCTGAGCGACGCCAAGTGCATTCCAAGCTGCCGGGCTGAACGGGTCCCGCTCGATGT
ACTTGCGGAGGTAGAACAGAATCTCTTCGTCACTGGGGTCTTCATCACTGTAGCCAGCACCAGCTCCATTACGCTTTGATTGAACTTGCAACGCCAACCC
AAGTAGTGCGTCGAGATCCATTCCATTCTGTAAAGCGCAGCTGAACGCTTCGATCGACTTGTCTTGCTGCTTGGGTGAATGGGTCTGGCGGCGCGCCAAC
ATTGCGTAGCCGTTCCACATTGCGGGGTTGTCGGCGTTGACACTCTGGAGCTGGAGGAACGCGCGTTGAGCCAGAGAGGCAGCGCTGGACAGCGCGTCGC
TTTGCGACAGGTAGAGCATGCCCATGTTGGCCCACGCAGCATCAAGATTGCTGGACTGGATGGCACGAGTCCACGCGAATTGTTTCACCAACAAACTGTC
ATGTGCCGCACCCAGTCCGTTCCACCCAAGCGCTAGCCCGCTATCGAGCCTCAGCGAAAGTTTGAAAT