Description :
From Genome Similarity Track
Location :
scaffold_11:15229- 17671
Transcript NameFunction/comments
Pl_112487transmembrane protein, putative
Pl_112488hypothetical protein PHYSODRAFT_484074

Sequence
2442 bases(100 bases per row)
TGTCATACGTGAACGAGTTGGAGTTGATCACACCAGTTGTGGACTGCACTTTTGATCTGCTGGTGTCAGGCGATAAGACGGTTGCGCGGATCTACTATCT
CACTCGTCAAAAGAGCAACCCGAAAAATGTGCTGCTCTTGTCGACGATGCTCTCAGCTCAAGACTACGAGGTGACACAACAGTTCCAGCGGGGAGCTGGA
ATGGTGCTCCTGGTCACTGCTATAGATGACATGCGCGCAACTAAATTAACGCATCATATTGCTGTCGCACTTAACTACCCCTACGTCGCCGAACCTGAAT
TCGCATATTCAGACCTACAAGGTATTGATGGCGATAACTACTGGATCTTACAGATATTGCCAAACCAGCGAACAAAAGATCCTTCCAAGGAAGTGATAAT
GGCTCGCCGCTTTGGACGATATAAAGGTGACGTGACAGCACAGTCAAACATCGAAACAGCACATTGGGACTTGTCGAGTGATCCGGCGACAGAGTTGAGT
GAATGGAGATGGTACAGTAGAGCTGTACTTCACGACTCGTGGGCCTGGGCACACGCTATCCACGGAATTTTTGCTCTCAACGTCATCTTTGATCTGAGTG
TATTGACATTTGTGATCTATCGACGCCTTCGCATGGGCCACGTTTGGGTTGGTGATGCATTCTCCACAATTTCAAGCATGCTACTCTATCGAGGCGTAAT
GGTGCTCATATGCAGTCAGTTAAACGGGTTTTGGACGATCACAAAAATGTGTATTTCTATCGGAGACTCGATCACGGATCTACACATTGTTTTCTACAAA
CCAGAGTTGGTACAAGCGGATTTGCTATCCATTTACATGAATGTGGTGAGTGTTTTGAGCTACCTAGCTCGTGAGCGTGTGGACCCACTGCTGGCGTTTG
CTACCTTTGAGCTAGGATGGGGATATCGTGTCGAGTTGGCCAATTTGTTTCCAGCCTTGAAGGCAAACATCGCAAACTTCGCGATTGCTGATACATCGCG
AGGTTTGTTGAAAGTTCGACCTGGACTTGCAGCCTTATCACCTATGCAATTGCTTACAGCGTATGCAATCCCAAACAACCGAGTGAACGTCGTGTCTTCG
ATTGTTCTCGCAATCTTCACCCCTATGTTGTTGGTTGTGGGTTACATTGCCGCCAGGAAAGTCGCCCATTGTGAGAGTGGGGGACATCGAAACGCTGCTC
ACCATCGATCAAATGCGTACAAGGCAGATGATCTCCAGCAAATTGATCTCACCTCGTTCGAATTGGCGACCGGTGCGGCACTGAGAAAGCGCTACGGCGT
GGTTTCTGGATACGAGAACTACACCATGCGTGACAATCAGCTTTTGGCAACGATTGATGCAGTTTACGGCAATGGTTTCCTTGTCGCCAACAATAGATTT
CTTGTCGCAACGCAAGACTTGATACCTTTGATCCTGATGAAGATTACACGTGTTCGCTTTACGAATATTTTCGTGTACGAGATCATCAACGGTTGCGCCG
TGAAGGAAACATCACGACTCGTGTACCCGACGACCATCAGGTGGTCTGATCTCGCCCGTCTTGACGTGACGGTGCTGTCGTAGATGATACTTTCTTAGCA
ACCGTTCTGCATAGCTGAAGACCCAGCGCTTAACTTTAAACAAGAGCCAACATCAATTTGGAGTTTCCATTCAATCTCGACAGAGAAACCGCTGTCTAAA
ATTGCTGCTTACTACGTCTTCCTCGACTCGAACCAAGTATTACTGCTGCTTTTAGCAGCATCTCGCAGATGCGAGTAGAGGGCTATTCTTGCTGCTGCAC
TTCTCGTCCAACAGCTTGAAAACTCATTCAAGCACTTCAGCATTTTTGGAAAACTCGGCATCAACTCGAAGCGAACACAGCCCAATTGTCAAGTGCTTCT
TCTAGGCAATGGGGACACCAAGTGCACAGGTGTCACCGACCAAGGGCGCCACTGTGTTGAATAGCACACCTGCCATGTCAAATGGTAAGAGGACCAGTAG
CGGGCAGAAAATGAAAAAGAAGCGAATCACTCGCGTCCAGCTTGTGAATCTCGTCAGGCGAATTACAGGAGTCGGCGCAGCACTCATGTGCTTGACCAAT
TACCTCCGTGCAACCATCGTCACATTTCAAGTGTTGAGAGGGTCTCCAGTCGATTCAAGATCTTTCGGTGTCATGGAATCCGAGCTCATTCTCGGGTACC
TTGGAAATGGCTCGATTGGTGACAGCTCGCTTGTAAAGAACATCTTAGGTGGTGATACTTCACCACGCGACTACGCACTCTTCCTCGAGAATGAGACTAC
GACATCAACAGAGAAGTGCGAGACGGTTGAGTTGTTTAATACAGACATTTACAACAGCTCATTTCTCCGCGCCAACTTCGAAAGTGTGATCGCAAGGGGA
TCGTACAATTTAACGCAACTAACCGACATGGAACTCGTGGTC