Description :
From Genome Similarity Track
Location :
Scaffold_17:152282- 154589
Sequence
2307 bases(100 bases per row)
GTAGGCGTCGGAGCTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCGCAGCACTTCCTCAAGCTC
GTCTGCGTCGGGAAGTCGTAACAGGGTCAGCCTGTCGGCCAGATCCACGTCTGCCACCGTCTCGATGAAATGATCCACGTGTTCCCGCAGTACCTTGGAT
CCCCCATCCTTGATTTTCAACTTGGCCCGTAGACCGGCCACATTCAGTCGATGTAGATATTCTAGCGGGGATTCATCCGATCTGCGGCGAGCGTGGTAAT
ATTGTCGTGCCACCGACACTCCCAATCCACAGTACTGTGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCATGGTGGATCAGCCCAGCTGCCGATA
CCAATTCCTGGCTGGCCCGCTAGCAGACCCGCAAAGGTCAAACACTTCTCAGCATCCGACGCTTGGTCTCTCATGAGGGTCGACTTGACTTTGCTGATCC
ATGTTCTCGCTCGGTCTTCATCTTGATCCTTGCCCGTGAACTCCTTCAGATCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCCGC
CCCGACTGCGGCTGTTGCTACCACCGCTGATGAAGGGGATGGGCCATCCAGATCATCTGGGTCGAACTCATCATGAGAGTTGTCTCCCTCCACTGACTCC
ATCTCCACGTCTCGTGTCCCATGTTCGTGGAGCACTTGCGCTTGTGGCACGGGCGCTCTCATACCCTGTTCGGCCAGGAAACGACTCATCGCAGCTTTGA
AGTGTCGCTGCAGGGTGACCGAGGAAGTGTCGGAAGAGCCTGTGGCCGTCTGGTCCACTGGCGAATCAGGATCTGTGAGGCGATTACCTTGAGCCCGATC
TGACGATAACCCCACTGGTTTCTTGCCGGATCTGGCTCGATCCTGGCTGGATTGTATCAGATCACGGGTAGGGCGTACTGGATCCCGAGTCTTCACGTTC
AAAGGGACTTCCTATCCCCGGGTCCTCGCCCGCGCTTCCAGCATGGATGCCCCGGAGGGTCCTAAAGTCATGTGTCGGGGCTCGGACGACGTGTCGGATC
CATCTTACGCCGCGGATTCGTAGTTCGAGGACGCAGCTTGGCTGATCCTCGGCGACGACACTGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTT
AACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAAGTCTAGCTCGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTCC
GTAAGCAAACGTAATTTATCTTTGACTGCCACCAACTTATTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGATTCA
GGATCTGCATGACAGGATCTTGATGCAGAAAATCGCGTAGAGCTCGGTGGTGATACACAAACTCGAGATCTTTGTCGGACCAGCTTTACCTGGATCCAGC
TTGTTTTGTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTCGAGTATTTTTTTTCGTCTTCTTTCTCGTTTTTTCGACTAGCGGG
CTTGTGTTTAGGTACGGTGTTGGCTTAACCGGTGAATCTGCAAATGCATACCACTTCGCATTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACGCAAGT
CAAGATCCGCAGGGGTCTCCGAGGGGACCTGGGGAGGATAGAGTTCCTCCCAGGACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTC
AATCCGACCTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGACTTAACAAAGTTCCGGGCAT
GTGGCGTAGCGGGATCAGCAAAATCTGCGAGATTGCTGGTTCCGGCTTACCAACATCGCCCAGACACCGACTAACGGAGGGGGTTCCCCGATGGTCCGTG
TTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTTGCTCTCTCGGTAACTTCCGAAGAGCTCAAGTGGTGAAGCTTGAGTGTCTT
GGCGAGACGTGGGGACGGGGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTGGATGGTTCCGAATCCTAAGCGAATATTCGAGCTTATGGATCCA
GGGCCTAGATCGTGGATCTGGTCGTAGGGTTGCCTTGCGGGTGTCCCTTGCCTTTGTTTTCCTTTACGTCGTACTTGCTGCCTCCTGTGACGGGATCTTG
AGAGTTG