Description :
From Genome Similarity Track
Location :
scaffold_5:152233- 159503
Transcript NameFunction/comments
g8123.t1hypothetical protein
g8124.t1 conserved hypothetical protein

Sequence
7270 bases(100 bases per row)
CTACTCTTTTCTTCTCCCCTTTGCTGTTCAGACGACGCGTCTTCGTTGGTGGACGCACTTCATCCACACTGCACTTTGGTGCATGAACCAGAGGTATAGC
TTCGTCCACGCGGCGCCTTTTCCTCTGTATTTCCTCCGGGGAAATAGTCTTGGACGTGGCAACGCTCACCACTCGAGGGGGTGACTGTTTCTCAGCTGAT
TTGACGCTCGAGTTCCCCCCCTGCTCCTTCGTTGCCATAGTTTCCTCCATCTTCCTCCGGGTAACTACCAGGGTTTGCTGCAGCTTCCAGAACCTGGTGC
CCTCTTGTTGGTCACGTGGAGGGCTCTGAGAATCTTGAACCAATCGAAGTACACCCGCCGTCAACCCGTTGCAGGTCGAGACGTTCTGGAAGCAGTAGAG
CTCCCTCACACCCACGTCTGGAGCAAGTTTCAACCCAACTCGAAGCAGTCGCTCCCATTTTTCCTCCGTCATCACCTGCAACTCCTCCACGAACCCCGCC
GCTGTAGCGGGCCACACAGCCACACACTTCCCATCAGCACTCGCCAGTGCAGTCTCCGCCTCCTCAAAAGCTCGCTCCAGTGTCTTTATTCCTTCCATTC
CGAAATTGGCATCGACAATTGGACTTCAACTGACTGACCATCATTCTTGTGTTTAGTGTTCTACACCTCAAATAGGTCTTACGCGGGAATAACCGTGCTC
GCCATTTTTCAACGGCAGTGCGCGCGGAACTGAGCGCTTCATTGACAGGTGCTGGCGCGCGAATGGAGTCTCCGCGGCGCCCGTCGGCGGCGTCTGGGTC
TGTACCAACGTCCTGTCTCTCTGATTCGTCATTTTCGCGGCCCGACAGCCCCCTCCAACGCCCGAACGACAGCTTCGCCGAGTCTCAGCAGTGCAGCGCT
GACCCGAGCGCCTTTCTGGGATTCCACGTGCCTCCGAGCGCCGAGGAGGTGGAAGTGGAGCCTGCTCATCTTCAGCAGAAGCAGAAACAGACCCCGAAAC
TGGTGCTGAACCTGGATGCGAGCACGAGAGGCGACAACGGCTTCCGACCTGCGACGTCGTACGAAAGTTCGATACGCACGTCCAACCCGTTCAGTGAATT
GTTTGAAGGCGACACGCAGGATGATGAGAACGTGGTGATAGACCAAGTTGCTGCAGAGAGACGAGGTGAACTGGTTCAGAAGAACATGAAGGAGGTTTTG
CCGTTGAAGAGACGGCGACAACGTGAGGATGACGCAGGTGCAGACAGGTCAAGTCCCCCGCCTACGATGCTGGCGTCGATGGAAAGTGCGTGGCGAGCTC
GCAAACGGAGAGTGGCTGAGAGTTCACTGGACCTGAAAGGGTCGACTGGAGAAGTGGATGCAGCACAGAATCAGAACGGCCAGAAGGATGTCCAGGAAAG
TTTGGACGCAGAGACGATGGATGAAGCACGCAAATTTGCTGCTGCTACTGATGCAACAGTGAGTCAAGAGAGTGCTGGGGGGAAACGCGCTGATGACTCG
CTGCCAGGAGCTAGCGCGTGTTCGGAGTATAGTGAAGACCTTGCTCCGCGGATTTTCCAGGCTATGGTTAAAGTTCCCACCAATGAGTCGATTATTCATG
AGAATTGTGGCAAGAATTCGACAGACCATGTTCAATTTGATACCAGTGCGATGTCAGAAGACAGCGACCGGGAGACCGATTACGAGGATGAACTGGAGTG
TACACAGCAGCTTGACGATGATGGGGCTATTGACGATATGGACATGACTCGCAGCTATGAAATTGGAAGCGATTGCGATGAAGAGGATACAGAAGTATAC
CCTTATTCTGATACAGGCACTTTACCATACGGGGCCGACTCGACCATTCTAGATGATGGCAACGATGACGAGGCAAATCCACAGAAAGAGACTGCGGGCA
GTGCTTCGAGAGAAGAAAAAATGACCCTTGTGCCGACGCCGGATCAAATCAGTGACCAGCGAAGAGCTGAGGACGAAGCAACGAGTCGAGAAGGGTCACA
AACTACCCAACAGGACTATCTGACTCCAAGAGTTGTCCCCAGCCGATCTAAACGATCCGATGCTGCCGAAACCAGCACAAATTTTGTCGTCGCAGTCGCC
CCTAGTGGTGATGATGAGCAGAGCTCGCAGAAGTCCCAACATGACAATGATCCAGATGAGTGCGTGCCTACTCAACCTAGTAAACCTCGGGCGGAGAGTG
AACCCATCGTCGAGCCGAACTTGCCTTCGCAACAAAACGTATCCAAGAAGAGCGATGTGCTTTTGACGAACGAGCATCTTGCTGGAACCGATTCTCAGGC
AAAAGCGATCCGCACACTAGAGTTTTCGTTCTCGATGCCTGAGTCGCAGGAAGGCGAGCCACACTTCAGTGCAAGCCTGCCAAGTGAAGGGGCAGCTGTG
TCAAAGAGATCAGAAACGTTCTCTCGCAGTGACAAAACAAGCCCTTTCGCGTCTTCTATCAGCCCGGTATGGGCGGCAATTCCAACCCCCATACCTGTAG
AGGGTTCTGCCGTTCCCGATGTCACTGGGGTCACGATAAGTTTGAAGAAGAAAACCACATCGCCATGTGATTTGCCGACAGGAAAGAAGCAAAAACATTC
TGCTGAAGGTACCGATTCCCCTAGCTCATCCAAGCCTAAGAGGAGTAAGCGCGGTTTTTTTACACCTGACAGTAGCAGCACGCCAAAAGAATCGGACGGA
GGTGATCCGCAAACTCCTCGGCCTCCTGCCCGCCGCGGCACTCGGTCCTCTCAGTCCACACCTTCATCAACCCCTACAGTTCGAACACGAACAAGAACAC
TAACCCCCGTGCCGTCACAGCGTGCATATGCTTCAAGATCTCGAACGCTATTCAAGTACAAGTTCGAGTTTTGCTTGACGGGCTTCGTGAAGACCGGTGA
AGAAAACTTGAAGGAGCTGATTGAAGGTCACGGAGGCAAAATTCCTGAAAGATACCAGGATGTTCTATACAAAAACAACGTCAAAGCTGTGGTTATCGCA
ACACCGGTATCATGGCGCAAGCGCAAGTTTATGCAAGCTGTGGCATGTGGAATCCCCGTCGTTCATACAGATTGGATTCACGATTGTATTGAAGATGGCT
ATGTGGTACCTTTCGATGGCTATCAAGTCCCAACAGGCTACTCCGTTACCACTCGAAAATTCGAGTGTTTCCCCCCTAGAGAGGTAAGTCCTCTCGAATA
GGTCGAACGCCTGGGATGGTTGAATGCAAAACTAACCTTTTTGCTGCGTGCGGTTGTGCGAACAGCTACACATTTTTGAAGGCTATTCCTTTGGTATTGT
CAGTGACGTGGCACAAACGTCGAAGGCAGAAGCGAAGGACAAGGCCAATCTGATGGCTTTTATTTTGAAGGCTTGTGGTGCAGATGCTGTATACGAGGTT
AGTCCATCGGTATCAGTAACACTCTGTACGGTCGATGTTTTGTCGTCCACTAACGCGTGTCGTGACTTGTAGAATCTGTCTACCAAGAGCGACGTTAACG
TGGATGTGGTGCTCTGCGACGAGTATACTCAGGTATGGAGCATTGATACCAACCATGCTGTATGATCTAGCCGTTTGACCGGTAATTGTGTATCCTTGTG
TCGTCTAAAATATAGACTTGCCGGTACTACAAGAAGAAACGCCGCGTGCCGGTGAAAGACTTCCAGTGGGTTACCGAGTGCATGATCCTTCAGGTACACA
TAGCATGAGATAATCCGTGTGGTAGGAAATATCGTCGATCTGCCAACTAACACAGAGTTTGGCTGTTTCTTAGCGATGTCTGGATCCCGAAGAACCAGTT
TTTGAACCACAGCGCGTAGGCTGCGTAGATGTTTTTGCAGCAAGCGCTGAAATTGGTGACAGCGACAAGTACGTTCTGGGCCTTGTTCTCCACGTACCTG
TGAATGGCTCGCTCATATATTCCTGTTGCGTCTTGGTAGCACGACCCTGAAGTTATACACGGGGGAGCTTGTGATGGCGGACATCTCGGGCAGTGCAGCC
GACCACTACCTCCTGTTCAATGTCTGCGAAATCCTCAGTATTCACGTAAATGCACGGAAAGATGAAGGCTCGCAGTCAAAGAGGAAAGACAAAGGAAGCC
GCGTTATGCTTCGTGTGGGCATGTTGAAACGGTACGCTTTGCTTTGTGTAGTTGCTTGTTGCTGGGCTAGTTGTGTTGACAATGTTGCACTGTGTGTGGA
ATGAATAGCGAGCCTTACAACCCCGAGCTGTCAAAATCCCCCGCCAATGTGCTGGAAATCTCATCATCACAAGTGAAACGAAGAGTGGTGGCGATTTCGA
AGGAGGACTATGGCAAGCTGAAGTATAAGGATGAGAGTATCTTTTATTTGGAGGAGGAGAGCGATCTGAACAAACTCGCCGTGTCTGAGCACAGATGGCT
GACACAGTGACTGCATCGTTGCTCTGTTGTTAATGCTATCACAAAACGCCTCCGCTTCAGGAAAATCTTTCTTGTGCGTTTCACTCGTGTTGCTCTTCAG
GGCCACCCTGATCTCGCGCATTTCGTTCATCAAGAATCATCCTATTGGGGATGAATAGATGGAGCCACGGCTAACAACGCGAAGGAAGCCAATTTAGTAG
GATTGAGAGTGAGGCTGTGCTGGTGCTGTCAACTGGCACGTACTTTTCGCATAGGGTCGACACCAGTGTCTGAGAAGATGGTCTGTTTGGAGAAACAATC
ACACGCAGCATTGAATTCGTAGGCTTTCCTCTGCTACCATTCGTGCAGCGTACCTGCCACGAAATAATGCCCAAGTGAGTAAGCATCATGCGGTAGTAGT
TGGTGAAACTCTCGGCCAGAAAACTCCATTTACCACGCAGGTCCCTAAACCAAATCTGTGGTGCTTCTGCTTGCAGTAATAATGACTTAGCCACAGTCCG
CAATATATAAGGAACAGGGAGTGCAGTACCATCGAGGTAGACGAGCGCGACAGTGCCGTATTTTGTCGATGTCTCGAGAAAAAATCCTGTGAGTTCCTTG
TGGTTGACCTAGAGCCAAAACCGTGTGAACTCAAACACGTCGCCAGAATACAATCCAAATCACACTCACCTTTCTCAAGTCGAGTCGATGCTGATCTACG
GGCCGGCATTGTGAGGGGAGATCCTTGATCGAGAACCGTTGCAATTCCTTAACAGGCTTCAGCAAGAAATGACCAACCAAGGTGGAGTGGTCTGAATGAT
GCAATCAAAACAAAACAAAACAAGCTGGTGTTCACAACGCTGCACTGCAACTACCCTTCTGCGAGATATCCTACCGCGAAATGGAGCAAACCATTTTACC
GACAACCCGTTTGCGATCGAATAGAACCGCTTCAAGTCGTCTGGAAGTAGATACGGGGAGTTTTTCTGGAGCAACGCATCAACGTCAGCATGAATATCTT
TTTCTGTTCTGGCCTCCCTTCAAGGTGTACACCTGCTCCCAGAGTCCAAGTTCCACCTGGGTAGCCCCAACAAACGGCTTCGACTCGACGCGCGACACGC
GCTCATGAGCTTGCAAGTACGAAAACACTCCGAGGGAAATGGCGTCCAAATGCTGCATTGGTGCTGCCGAAGAATGAACGAGCGCTCAGATTCTAAGATA
AGAGCTGCACGGGAACAGGCGGAGCCGGCGTTGCAATCCTCTAGCAATATTACGACGGAATAGCAGCTATTACAACGATCCCCTGAAAGTGCGACGAGGC
TCGACTACATGATTGAGCACTGCTCTTGGCCTGGGCCGCCACCAACTAACCACAAAATCAGCAAGAAGCAATCAAGAATTAGACTCTCTCCTGGACAAAG
TATCAAAAGTTGGACTTACGTGGCATGCCAGGCATTCCAGCCATACCGGGGAACATGCCAGCGCCCTGCAGAACCCGGACATAACACAGTTAGACCCTGT
ACGTAGTTTCTGCTCCAACGTTGTAAAGTAGAACGAACCATATTCGGCATAATCGGCATCCCTTCGTCATCAAACTGCAAGCCTGTGCACCGAGTTGAAT
AAAGTAGAAGTAAGACGCTTCTTTTCAAAAACAACAACATTGACTGAGGCGTACCTGGGGCAAGGTCCTTCACGATCTCCGAAGGCGGTTGGCCGGTCTC
CTGCATCTCCTGCATAAGCTCTGACAGTCGAGCGTAATTATCCGGCTCTGACTCGTACGCTGCGACGATCTGCTGGAAGTACTGGTACTGCTTGCCATAT
CTGCGCAAAAAAATAAACAGCTCACATTCAGGAAGGCAGTCGACAGAAAGCACACACGGATACACAAATGCCTACCGCTCGTAGTCTTCTTTAGACAACA
GCGACTCCCTTCTCAGCTAGCCACTCAGGATACTACGCAAAAACGCAAAAAAACAACAACTCGTGATTAGCCTCCATCAAGCAGCAAAGTCATACCCCTT
TCAGTACTTGCGTACCCGCTCGCAGATCTGCTTCATGGGATCATACATAACGTCCTTTGATAGCAGTTGCTGCATCATGCCGTCCACCAAGTCCTGGAAA
TCGCTCTGCCCCCAAAAATCACCGTCAATAACCAGACACAGGAAGTCACTCAACTCCTGTAGCCACCGCACCTTTTCGCCCATCTCTTCAAACTTCTTCA
TCATCTCCGACATCATATCCTCGCCCATAGCTTCCACCTGGGCCGTACCGACGCCCTCCATGTCTTCCGCCGCCTTGGCCATATTCTGCAGCGTTTTGGC
CACGCCAGCGTTCACATCGTCCGTCTCATCGGGCGTCGCGTCCACCTTCAACGAGCCCAGCAGCTGCTCGATGTTCTCGGCGTCGTCTGCATTCACCACA
AGAGCATCAGAACCTCTCCATCAATCTCTTCACTTGACTCCACTATACCGTCCGTGCCCAGCTCTCGAAATGCCTGCTCCAGCACCTGCTGGAACTCGGG
ATTCTGCGCGTCCTCGAGGAACTTAGCCATGTTCTGCCCCCATAACCACAGCGTCAGCGCTTCACTTCGCCTCGATCAAGTTCTTAACAGTTTTGATAAC
CTCTTGCAGTTTGTTGTCTTCGCTGTCCCGCGTCGCAGCAGCGGTGGCGGCCGCTTCCTGCTGCACGGTGGCCATCTCCGAGGCTTGGGCGGTGCTCACC
TCGTCCGCAAAGTCGTCCAGCGCATCTGCAGAGACGGACAGTGAGCGGGTGTGTGTGTAGGTGAAGGAGGCATGGGTGGTTACCTTCGAGGAGATCGTCC
AGATCCACTTCCTCCTGCGTCTTGGGCTCGCTCTCCTCCTTCGTGCTCATCGTCAGGCTCCGGTTGACGT