Description :
From Genome Similarity Track
Location :
Scaffold_246:15223- 20515
Sequence
5292 bases(100 bases per row)
CCCGTTACACCTGGTAGCACTTTGTAGTCCGTCCAATGACTATGAACATGTTGGATGATGAAGCGGAAGACTTCCATCCAACGCACGAGAGCTACTCCCA
TTTAAGTTAAATCGAATGGGATGCCGTCGAACGCTTGAGTTTGACCATAAGGAAGAAGCCGTAGGCGCAATGCTGTCCGCTCTGGGTCCAGACGGGCAAC
ATGCCACCATCGCCAAGGTTCATTCAGAATGAACTTGACGCTGAACGGGGATAGGTAGCCTTGCTTCACCAACAAGGGTCTCAACAGCCAGAGCTGTTGA
GAGAACAGAGTGCTCAACAGTTCGAGTTGTTGAGACAGCAGCAGGCTGCTGCCACTGGGTCGACACACTCACGTCGACCCGAATCACTGAAGACTGACAT
CTCCAAATACAAAGCAGCTGACGGAGATTCTCTGATGAGATGGTTTGTTGAGCTAGATGACGCCATAAGGGCTCGTCACATCGTCGATGAGCAAATGCAG
GTCGCATTTGCTCAGTCGAATTTGGCAGGACGTTCGAAGACTTGAGCCTTGCGCCTCAAGCTACACGACCCATATGGCTTTGAGTTGTTAGAAGTCTTCA
ATTTCCTGCTTAGGCAAACATTCGAACCACCGCGAGCAGAATTCAGGGCTCGCTCTGAACTCCTGAAACTAAAAAAAGCAAACGTGATGTACACTCATAC
ATTGAGTACATACGTCACCTTACGAGTTGCATTACAGCAAATGAGCCGAATGAACAAACCTTGATTACTTTATTCATTCAGGGTCTCACGGATGGTCCAG
TCTGGACGTACCTCTTCCGACTGAAATTCCATACCCTGGGAGAGACAATTCGTGTTGCGGAACAGGACGATTTCGGTGTGAAACGAGATCACGTGAATTC
GAATTCCTATCGTCCCTTTATGCGACAGGAAAGCGGGGCTCAGAACCGATGGACCTCTGTTACGCTGAGAGTGAAAGCTCTCGCGTTACCAATTATAATA
AATTGCAGATATGCAATAGGTGTCAAAAGCCAGAGCATTATGCATATGAGTACAGTGCCCCGAACGCGGTACCACGTACCGCAGGAAACAGTAAACGTCA
AGCAGCCAAGAAAGGTCCGAGGCGTGGGTCCGACGCTGTTGTAAAAACGCAACACCGTAACGGACAGCCAAAAAATGGTCAGGGTCAGTAGGTGCGGAGC
TTCCTACTGATCCAGCAACGTCAAGTGAATTTGCAGGTCTATTGACAAGAATTGTTCTTTACACGCAATCATTGTGTGTTAATGCATCCGGTAATGAGGT
TTCCTCATTACCTTGAAACTCGAAGTGGCAAAGGACATGTCACTACGAGCCCTAGTTGATTGTGGGGCATCGAACGACTTTGTGCTACGCCAGTCGCTAG
GTGACAGCAAACTTACATTTTATGAGAGAGAGATCCCTTCCAACGAGAATGACGGTACGCCTTGCTACTGGCGCATCCGTAACAGTGATGAAACGTGTAG
TAGGGCCTCCCTATACACTGAAAGAAGTCCAATACGACGATGACTTCATTGTCTTGCACTTTGATCACAAATTTGATGTTATCCTTGGTTTACCATGGCT
CAGAAGGTACTAGCCACGAGTCAGCTGGCATCGACAAAGTGTCGATATGTCAGCCACTTGTTCACCAGACGCCCATCTGATGAGCGTCTTGGAGCGTCAA
CCACCATGTGGGTGTACTACGAGTGATTGCGATGGCCTCAAGTGTGGTTTGGTCGTTAGTAAGACTGCGCAAGATCAAAATATGACTAATCATCAAATTG
AAAAGCAAGATTCCAGCGACTGCATAACAATGCAGAAAGCGCCAAAGGCCCACCTCTCGAATAAGTCGAGCGAACCGGGGCATGGTTGTACTCTTAGTAG
ACAACACCCAGATCATTACCAACCAATTGACAGTGATACTCAATACGGAGATGAAATAGCCTAAGAGGCTAGAGTTGAGAGAATGAGTCCCCAACAAACA
GTGGAAGTAAGTTTCCATGAGATAACAGAGACATTGAATGTCCTGGTTAATGACAGATCAAGCATAGGTAGCCATATGCTTGATCTGATCGCGCCTCCGA
AATTAACTTCGGAGATCACTCAGTTACCCCTGCTAAACCAAAAGAGGTTCTTGCGTGATCTGCGTAGTGGCAAAGTCAAGCAGATCTGCGTACTCGTCGC
GGAGGATGAGTAAGTCAGTGATATCCGATCGGCAATGGTCCTTGCCGAAAATGAACGAGTTCTCAGTAGCTCATCAATGAACGAAAGTGTTCTTAAAGGA
AAACTCGAATTGAGCGATATACATCCCAATCGTGGGAATCGCTCAGAGCAAATCCTCTCTACGATGATTTCATGGAATTCAGGGATGTATTTTCAGAAGC
AGTCCCGTGCGAGTTACCTAAGGACAAAGGTACTCGTCACGAAATCGACCTGAAACCGGGTTCGAAGTACTTTGTCATGAAGCAATGGCCACTGCCTCAT
GAACAAGTACTTGCGATCGAAAAATTCTTTGCAGATCGCTTAGCAGCCAGCCATGTGAGGGAGTCAACCCCCCTCACATCTTTCCGACCTTCTGTGTGCG
CAAGGCCACAGGAGGATGGCGGATAGTGCAAGCGTTCAACAAGTTGAATGCTGCAACGGTACCGGCTCAGACGCCGATACCGAAGGAAAGATGTCATCAT
AGATGGTATGGCTAAGAGTAGCATCTTTTCATCCATGAATCTGATGGATGGATTCTATCATATCGTTATGCGCGATAGGGACATTCCTTATACTGCAGTG
AGCACCCCAAGCGTTATACTTTGGGAGTGGTTAGTAATGCAACAAGGGCTAAGTAACGCCCCTGCCACATTCAACAGATGTGTAACGAGTATAATAAGAT
CCGTAAGAGAGTTCACGCCCAGTTACTTCGATGGTGTATCCTTCCATAGCCGGGCTATGGATGGAAAGATGGACGTAGAGGTTCATAGAACTCAGGTTCG
TCAGGTTCTTACACTTATGCGGAAGCATAAGCCGTATGCCAACCTCAAGAAGTGTATATTCGCTGCTAGCGAAATACCACAACTTGGATGCATCGTGGGT
AAACACGGCGTACGCCCTGATCCCAAAAAATCAAGGCGATCACCTACTGGCCCATGCCAGTAGATGTCAAGGGACTGAGGAAGTTCCTTGGGTTAGCAGC
GTACTTGCACAAGTACTCACGCAATTTCGCCGAAATGACTGTGCATCTTTCTTGTATACTCAAGAAAAAGGAGAAGTGGTCATGGAACGCTGACTATCAG
CGTTCCTTTAAGGATATCAAGCAGAGCTTTATGCAATCGCCCATTCTGGCGATTGAAGATCAGGACAGACCATTCCATGTGGTCTATGACGCCAGCGATT
TTGCGATCAGCTGTGCGTTGGTGCAATTTGATACAGATAGCGCAGAGCGCGTCATCTGCTACCAATCGCGTCAGCTGCAAGCAGCTGAGCGTAATTATCC
AGTGCATGACAAGGAACTCCTTGCCATGAAATACGCACTGGCTAAGTTTCGTGTCTATCTCTTGGGAGATAGACCGTTTGTTGTCCATACGGACCATGTG
TCACTACGCACGGCCGTAAACAGTCCACACCTCTCGCAAAGAATAGCGAGGTGGCTGTCTTTCTTCGCGGAGCACAACTTCTCCGTCGAGTATAAACCAG
GACGACTGAATGTCGTCGCTGATGCGCTTTGGCGCCGACCCTAATTCGAGCCGGGCGGGCAATCCAACAGTGATGGGAAGCCTACTGTTGCGATACTTAC
AGTCAGTATCCCGTCTTCAACGTTACTTGACGACGTAAGAAAGGATTGATGGATCATCTAGTGAATCCAACTCGTAAATCGATGAAACATTTATCGGCTT
TGTACCGTTCCTCATCAGATCAGTACGCAACGGGTTGCTGTACTATACAGCCGTTGCCGGCGAAACTCGTCGTGTCGTCGTAACCGCTCATTACAATTTG
TGCTTGCGCATATTGTATGAGTGTCACAATGGCCCAACAGGTGTCCATTGTGGTAGGGAGAAGACTTACCTTACGTAAGTCGTAACTTTTACTGGCCCCA
CCAGTATCAGTTTGTACGCAAGTACATTCGTGCTTGCGAGGTTTGTCAATGAGTGAAGCCTAGTCCTTTATCCCGTGCACCATTACAGCCTCTCCCTGGC
CCGGCAGAGTGATGGCAGACCGTTTCCATAGACTTCGTCTTCGGTGTTTCCCCGAACATGGCTACAAGAATAATGGTATTCTTGTGTTCGTAGAATGATT
CAGCAAGATGTTGCATCTTGATGCTGTACCCGAGTCGATCACGGCACAGGGCTGTGCTCGTGTCTTTATCGACACGTTATTTCGACTCCACAGTCTACCC
CGTGAACTAGATTCTGATAGAGATCCTCGGTTCACGGCGACATTTTGGCAATCCGTGTTCCGACCACTCGGAACGCGATTGAAGATGTCAACATCTGACC
ATCCCGAAACAGATGGTCAGACGGAACGTGCAAACCGTATCCTCCAAGACATAACTCAAGGATATGTCCACTCGTTCTCGAATTGGAGCAAATTCCTCCC
CATGGTGGAATTCGCCATCAACAATTCGGTGCATGCGTCAAACTAGCACACACCGTTCTTCGTGAATGACTTACACCATCCACGTCTACCCTCCCTCTTA
GAGTGTGACTCTTGGATAAGGAGGGAGGGACTCGCTTGAGCAAAAACCGTTCTGGCTCGTGCTCATCACGTGTCGACGCTAACGTCGTCACGTATGATGT
CGATGTCGACCTGATCGACATCGAAGAAGACGGTCATCTCAATAATAGCGATGACGCTATTATTCGAGGATGATGACACCCTCGCTGAAAAACAGAAAGA
GGAAAGAACTCTTTCTGCAGTTCGCACAAGGTGAATTAAACAAAACAATGTCTCGCCATCAGAAGGATTTTACTGGTTTGCGAAGCAGTGGTCCGTTTTG
TGCAGGACTCCATCGCTCACACGGTGGACCGTCAGAAACGGAACGCTGACAAGAATGGAAGAGCAAATGTTCTTTCGTTTATTGAAGGCGATTTAGTCCT
ACTATCTACGGCAAATCTACCTAGACACGTAGTGACCAACGTAGGCAGCAGTAAACTACTGCCCAAGTACATCGGCCGCTTTCGTGTGCTGCGCCGACAA
GGCAACGCATACACGATTGACCTGCCGCGTAGGATGCGTACACATCCTACATTTTACGTGGGGTGTCTCCGCCCGTACTGTCAGTACGAGCC