Description :
From Genome Similarity Track
Location :
scaffold_55:15221- 16491
Transcript NameFunction/comments
g2471.t1 hypothetical protein PHYSODRAFT_342406

Sequence
1270 bases(100 bases per row)
GCGGTCAAGGCAGCGTCGGTTCGAAGCGTGGTGACGGATGCTTTAACTGTCACGAACAAGAGCACCAAGTGCGCGATTGTCCGTATCTGGGCAAGCGCCC
TCCGTTCGAGACCCAGCGTGGAGGCTCTGCAAACAAGCGCAGTAAGTTCAATGGAGGAGACAAAAGTGCCACGGCCGGCAGTAAAGGTGGAGATGATAAT
GGAAGTGATGACAACGCCTATGTGATTATGAGTTTGATGAAATTGGAGAAAAAGGTGGCTGATATTGCTCATGACCGCTGGTATCTGGACTCAGGGGCTA
CTAGTCACATGACGAACCAAAAAGAAGACTTTGTGTCGTTCACTCCTGTAAGTTCGACAGTGCGTACTGGTGGCAAGAATTGGCTGGAAGTCGTTGGCGT
TGGGACAGTTAAGAAAGAACTGATCACGTCCAGTGGCAGAGTTTTGGTATTGCTGCGTGGGGTACGATACGTCCCGGACTTACAGTGCAGCTTGTTTTCG
GTGGGGAGACAAGCTTCACGATCGCTTGAGTCTACAGAACGAGTGCGATGCCATTTTGATGATGATGAATATGCAGATGTACTTCTTCCGTCAGGCCGCA
CTACCGCTCGCAGAGACGAAACCAATCTCTATCGCTTGAGACTGGGGAGGCCGTCAGATGCAGCGATGATGGCATCGTCTGAAGGAGTTAACAAGGTTAA
ACTGTGACATGATCGCCTTGGGCATCCCGGGCGAAACGCGTTCAACGCACTTTTTCGACACACACGTTGACCAATGAGGAGACTGGAACTTCGCGTTCCC
AATGGGTTCAGTTGTGATACGAGTGTGAAGGGCAAGCTGACCCGGAAAAGTTTTCGCAACACCCGTAGTGCACCAACACGTGAGTGGTTAATCGGAGAGC
GTACTCATATTGATATTTGGGGGCCATATGCGATCGATTCTTACTCTGCCAAGCGATACTTTGCCGTGTTCGTCGACGAAGCCAGTCGATTTGCAACACT
CTATCTTTTGGCTGAGCGCACAGAAGTCTACGAAAAACTGGACATCTACTATCAACAAGTGAAAACTCTGTTGAATGTGCGCATGAAAGAAGTTCGCAAC
GACAACGCGAAGGAATTGTCTAAGCTGGCGGTAGTTTGTACAAAGAAGTACGGCATGGAGTGCACGTCCAGCGTCAAACACGCACCCGAACAAAATGGTG
TGGCGGAGCGAATGATTAGGACAATATCCGAGCGAATGAGATGCCTATTGAATCATTTTCGGTTGCCGGA