Description :
From Genome Similarity Track
Location :
scaffold_171:1522- 2688
Sequence
1166 bases(100 bases per row)
TCCAGGTTGAGTTTCTGGTTAGACTAAGATATGCTTATTCCTCAGCCTCACCAGACTTTGGCACGCAGTCGCGCTGAGATAGCGGTGCGTACGCAGAGTC
GGCATGTTAACTCTAACTGGCGCTGGCGCTTACCTTTTCAGCATTCGAGCGATTCTTGGTCTTAGGGTTCTAGAAGCGGTACTGGAGCATCACGTTCAAT
TCTGTGTATCTGTACCCACAGAACTTACACGTGAACACGTTCTCGTCTTCATCGACTGCTGCAACAACATCTGACTCAGACTACTGCAACAACAGCCGAT
TCGAACCCGGGCTTGGAGAGGTAACGCAGCAGTGCAGTTGATAATTGACTTCGGCAAACGCTATTCCACGTTAATCAAATCGGGTCAAAGCTCGAGCACC
TTGGTCTTCATCTTGTCTACCGTTTCCAACCCAGCAAAGACGTGTTCCAGTCATCAGCGCGATGGTCATGCTGCACGGGGTTGTCCCAGGAACGGCATCC
GGCTCACTGACAATTGCTTCCAGAATGTAGTACTTGTGCGGATCTTGCTCTTTGCCGTTACCCGTCGACCACGGAACTAGTACGCCCGTCGTTCGTATCG
ACTCACGCTGCGTAGGTAGCGTGCTCGTTAGGATACTTCATTTCCACGGTCCTGTCTCGGGGCCCACGTTGTCGAGGGTAGGCTCGTAGGTACGAGCTTT
CGCATCGTCTAGAAGATTAGCTAGGACATCCTCAGGGAGATCCAGAGTACCCATGCGGGTAGCTCTGGATACCATATCGAGGACGATTCCGTTATGCAAA
GAAACGATCTGTGTAACGGAAATGATTTGAAACGGAAACTGTTTATGAAATGGCCTGAACCGGTACCCAACCGTTTCCCGGTTGGCTTTGATATTTGACA
AGTATGTGTCTGGAGCCGGGTCTGCAAGCAATTTAGTTTGAACTGCATTATCTGACAGGCCGTTAAAGACCCGATTAATCTGTTACCGCGTTGAAGAGTT
TATCCTGGAGGACAAGCGAGTGCCTCTACTCAATAGAGTCTACTGAGTTATAGCCAATCCAGTCGCGTAGGTCCTCTATGACCAAGGTTCGGTATTGTTC
AATTAGCTAGCTGGAGGCCTTTTCGCTCGAACGTGACGCAATTGTGTGTTGTAAAACCAGACTTCA