Description :
From Genome Similarity Track
Location :
contig_55:15219- 16490
Transcript NameFunction/comments
g10934.t1hypothetical protein

Sequence
1271 bases(100 bases per row)
CGTGGTGACGGATGCTTTCACTGTCACGAACAAGAGCACCAAGTGCGCGATTGTCCGTATCTGGGCAAGCGCCCTCCGTTCGAGACCCAGCGTGGAGGCC
CTGCAAACAAGCGCAGTAAGTTCAATGGAGGAGACAAAAGTGCCAAGGCCGGCAGTAAAGGTGGAGATGATAATGGAAGTGATGACAACGCCTATGTGAT
TATGAGTTTGATGAAATTGGAGAAAAAGGTGGCTGATATTGCTCATGACCGCTGGTATCTGGACTCAGGGGCTACTAGTCACATGACGAACCAAAAAGAA
GACTTTGTGTCGTTCACTCCTGTAAGTTCGACAGTGCGTACTGGTGGCAAGAATTGGCTGGAAGTCGTTGGCGTTGGAACAGTTAAGAAAGAACTGATCA
CGTCCAGTGGCAGAGTTTTGGTATTGCTGCGTGGGGTACGATACGTCCCGGAATTACAGTGCAGCTTGTTTTCGGTGGGGAGACAAGCTTCACGATCGCT
TGAGTCTACAGAACGAGTGCGATGCCATTTTGATGATGATGAATATGCAGATGTACTTCTTCCGTCAGGCCGCACTACCGCTCGCAGAGACGAAACCAAT
CTCTATCGCTTGAGACTGGGGAGGCCATCAGATGCAGCGATGATGGCATCGTCTGAAGGAGTTGACAAGGTTGAACTGTGGCATGATCGTCTTGGGCATC
CCGGGCGAAACGCGTTCAACGCACTTTTTCGACACACACGTTGGCCAATGAGGAGACTGGAACTTCGCGTTTCCAATGGGTTCAGTTGCGATACGTGTGT
GAAGGGCAAGTTGACCCGGAAAAGTTTTCGCAACACCCGTAGTGCACCAACACGTGAGTGGTTAATCGGAGAGCGTACTCATATTGATATTTGGGGGCCA
TATGCGATCGATTCTTACTCTGGCAAGCGATACTTTGCCGTGTTCGTCGACGAAGCCAGTCGATTTCCAACACTCTATCTTTTGGCTGAGCGCACAGAAG
TCTACGAAAAACTGGACATCTACTATCAACAAGTGAAAACTCTGTTGAATGTGCGCATGAAAGAAGTTCGCAACGACAACGCGAAGGAATTGTCTAAGCT
GGCGGTAGTTTGTACAAAGAAGTACGGCATGGAGTGCACGTCCAGCGTCAAACACACACCCGAACAAAATGGTGTGGCGGAGCGAATGATTAGGACAATA
TCCGAGCGAATGAGATGCCTATTGAATCATTTTCGGTTGCCGGAGGAGATGTGGGCAGAGGCTGCTGTGAC