Description :
From Genome Similarity Track
Location :
Scaffold_370:15216- 21924
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_370-snap-gene-0.10SH3 domain-containing protein PJ696.02
Pytap_DAOMBR444maker-pag1_scaffold_370-snap-gene-0.11P-type ATPase (P-ATPase) Superfamily

Sequence
6708 bases(100 bases per row)
TTGCACGTTTTACAGTTCTTGTTCCAGATCTGGTGCGTGTGAGCAACAAaCATAGGGCAGTTGCACagTCGGCACGGGCCcATGAGcGAcGCACGACGGG
ACACTGTTtCCCGATGCATCTCGACGCCCTGCATGGCGTTGTTAATAGCCTCGTAGAGTGGTCGTGCAGCATTCGGAGGAGCGACATGTCCACTGAGAAT
CTCACTCGGCTGCAAGTCACGACCATAGAACTTGCGGTTCAAGTCGCTGCGCGGAACAATCACCTTGCCGTGCAGCGAGATGCCTGCGTATAGGCCCTTG
CTCTGCGAGTAGCTGTAGTTGGCGTTGAGACCACTCGCACTGACGGCTGCAGCAGCCGCCGCCGAACGTCCGTATGGTCCCACTGCGAGGTCCAagCCTG
CACCGATGTTCGCTTGAGGCTTGTGGAACACCTTCACTGCTCCTTCTGATCCGAGAATAaTCATCAGCTCAACGATCTCGCCGCCGATCTCGAACCCGCC
GCCCAAGCCACCGACACCAATCGCcGACGGAGCCGACCATGTGCCATCAGGAAGCTTTGCGACTACGAGACCGGTGCCGATTTGTCCAGTAACCAGAAAA
CCAGCTTTGATAATCGTCATGATCGCCAGACCATGTGCCTTTTGCAaGAACGCTACCGGAATCGAACGATCAGCGGATGCGCCCcAATCATCGCGGAAGA
AGTTGCCGATGATATCGGCGGCGTTCTGGCATTCCTTGAatAGCGAGTTACTGTAGGGGACGCGGATGAGCCTTCCTTTTGCCTCGTAAGCGTTGTCTTC
GTTCGCCTTtGCATACTGGTtGACCATTTGGTCCTGGTACTGGTGCAGCTTTGGTGCACACTGAATGCAGACGCGCTGAGGCGCTGACGGCTCATAGCCC
TTGGCGCCCGTAaTTTCCATTCCTGGCGGGATGAGCAAACGCAGTGGAGAGCATGAACTGCACACGTAGAGACCACAATGGCGGCTACAATACGCAGGAG
CACTgTAAGCAGACAGCTCACGACAATAAACGAACGCGAACGAGGACGTACCACTGGTGTCGGCGCTTGGTGACGTCAAACATGACGTTGCAGACATCAC
AGTTtGGgTGGTCGGCATATCTGCCCTTGAgAaTTCCCTTGGACGACCCACCGGCAGgTGgTTGGCCGTTGTAGCTGCTtGTGCGATCGCGGAACGAGTC
ACCCGAAGACGACGAGTCCCTGCAGCGCCTATGGGTGAGCACCTCACcAGAAGACATCGACTGCAACTGACACATACCTGTGAGAGAACGACGTTtGCGC
GTtCcACGCGTGGGGGgACGCGACGGCCACCGGGCGCTTGCTGGCGTTGAACTCAACGAGCTCCTTACGACGGTCATCGTCTGGCACAAGTCGTGCGAGC
TCCGGCACAAATGCGAGTGTGGCGTCCGTGCCGAGTTCGCGCACGAGGCTGTCGTagaaCGTTTGCACGTCCATCTGACGGAGACCGTAGAGTCGGCAGT
TCTGCTTGAACGCCTTGACGGCTTCTTCATTgTTgCCCCCGCGAGACGCGCGCATCGTCTGAACGCACTTCTCGTACACTTGCTGGGCTTCAGGgCCCGT
CGCAGCAGGAGGCACGGGCTCAGGCGCTGGCTGGGCAGCGACCGCATACGGTGgTTTGTAAACGCTAGGGCTACTGCCTCCGTTGTTAAACGAGCCTGAC
GCCCCACGGGACATGCCGGCAGCAGCCGCAGCCGGAGATGCCGCGTTGATCGGCGTTGCGACTGGCACAGGCGACTGCCGCTGCTGCCATTGCGGCTGGG
CTGGTGCCGGCGGAGGTGGTGGTGGCGGTGGCGGGATCTGCTCATACGATGGGCGGTTGGCTGCGTTGTAAGTGCCCGCGTTCGGCGCTGAGTAGCTGTT
GCGTTGCCACGGCGTCCCATTGGCGTTCCCATTCGCGTTTCCGCTGGCTCCACCATTGACGAAGCTGCCGTTGCTCATGAAGCTCGCGTTGCTGATGAAG
CTCTTGTTGGCGGctGCCGCCTGCGCCACTTGTGCGGCCTGTGCCGCATACGCCGGCAcGGTCGCGGGGGCTGGCGTGGCTGCTGGCGTGGCTGCtgggg
TGGGCTGCTCTGTGAAGCGGAAGCCGCACTCGGCACAGAACTTGCCTCCCGTCGCGGGCGTGCCGCACTCAGGACAGAACTTGGACATGGCGTTCGCGGG
GCTTCGACGTCTGTGGCGGAcGGCGGGGGCACGGGCGTCGCGACTTCCAGTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATTTGCACCCATGGGCAATGGGCTCAGGGCCTCTCTGA
TTCAGCGTGCCCATCGCCAAtCGGCTGACGCAGCACCATGATACAATGATGATGGTCATCTGCTCCTGTAGGATGGGgATGCAGCAGAGCCAGATGCCAT
CAAGCAAATtCTGGAGGGAGACCGCAAACATTATGCAAGACAGTACTACTACAGTGtAaTACGTAGCAAGCATTTCATTCACGGTACTATATCGGcATcg
ACTAAACGAACAGCCCCGTTGAGGACCGTTGGCCGCTTCCACTTCCACTTCCTGAAATCCGGCGATCCGATAATCGctCGTTCATGAATGGGTCTCCATA
GTCAGATGCTCGCGAGTTCTCTCGAGACACGCGTTGGCGACTCTCGGCTTCGTTCATAGCGGAcGAGGCAGATGAAATACTGCGAGATGCCATGTAGGAC
TCGGCCATCGTAGTCTGAGGATCGTAACTGAATGCAAAGCCGCTTGATACTCGCTTCTTTCGTTCTGATGGCATACGCGAGACACGCTACAAGCAAAAGT
AACAGTCAGAATACAATGAAGAAGAAAAACAAGTATACCCACgTCAAGCCGTagCCTCAACTTCTTCACCCACAGCGAgaTAGGAACGGTCAGCGTCTGG
GGAATCTCCAGCTTCCAGATCCCATGACGAGgCGGCACCAGGGCCGGCAGACTTGCTGATAACGAAACGCTCCTGAACGATCTGCCACGGCTCAGGGTAG
AAGCGACGCTGAAATGCAGTCCACGCGAAGTGTCGAAGCAGCGTCGCAACAAGGCACACTGGAATAaGCATCCAGTATGTCTCTTGAAGAAGTGTGTTCT
GAAAGCTGCCGAAGTCAGTCGAAAACATtGCcACCCAGTAGCTTGAAaCAATAATGGACACTGGGAGGTACGACAGCACTCCCAAGAACCACAAGATCCC
GCCGTATACTGTCCATGACATCTGGAGCATGGTCAGCTTtAAGTTGCAGACAAGAACAACGAGGGTGAATGTGACGAGACCGTATTGAACCATCGGAGCA
CTGCCAGTGTTCGACAAATCCTCGTTGAAGCCGTAGATCACGAAGAAGGCGATCATACCAGACTCGAAAATGGCGCTTGCAATCCACTTCAAGAAAGTGC
GAGTGTTAAAGAGCTCCATGCGAGGACCGACTTGGTACAGCTCTGGAAaCTTGCGAGCCACCTCCCATGGAACGTCGTAGTCAAAGACgCCGAGCACAAT
AATCGGCAAGGACGTGTAGGCCAGGTTATACAATtGGAAGCCTAATTCACTGTAGAACTTCTGGCCCGACACGCCGGTTGAGAACATGTAAAAGTACTGA
GCCAGAACCATGACGATGTTCTTGTAGAACATGTAGCCAGCAAGAATCGACATGCGCTTGTAGTTCAGACGGCCATGATGCAGCAACAGCTTCTCCAAGA
AGTAGAACTGACCGATTGCATAGTCACTTGAGTTGACGGCTTGCATACCCTCTTGACCACAGATGCCGACACCGACATGCGCACGCTGGATCATAGCCAC
ATCATTGGCACCATCACCAATTGCGAGGGTGCGGGCTTTCTTGTTTGTCGATCGAACGAGACTCACGACTTCTGCCTTTTGGCTCGGAGATACTCTACAG
CAAACCaCAGCCTCACAAGACATAGCAAGCTTTAGGAATTCGTCACGGCAACCATCGTCGAGAAGCGTCACTTCTAAGCACTCGCCATCAATCACGACAG
CCTTGCGCTGATGCCCTTCGCCACCTTCGGGGCGATTGCTTTCAACCAActGACTGTACAGCTTCTCCTTGCTTGGGAACAGTTCCATGTTCAGAATAAT
CTGCTTCATGTCATTGTCCATAAGCTGACACGCGTATGAAATGTTGATGGCAGTTTCTTGCTTGTCACCTGTGAGCATCCACACCTTCATACTAGCTCGC
ATAAGATTCGCAATAGCACGGGGGACATGCTGCTGAAGCTTGTCCTCAATAGCTGTTGCTCCGAGTAAGACCAAGTCCGTTTCGATTTCGGACATGAGCG
CGTCAATCTGATTtGGTTTGCCGTGCTTTCGTTTCTCGATCTCCTCGAGGGATGAGTTTGCGGCCTTGAATCGCTCGCTCCACTTTTCATATTCAGTTGC
TTCGATTCGGCGACGAGCAATCGTGAGGGTGCGCAAACCATCATCACCGAATGACTCAAGATGACTGGTTGTCTCACGCAAGAGGTCTGGGTGGTTCTTT
GTTTTCGAAAGTAGAGGATAGATCATGTTGTCAGCCCCTTTTGTGAGGATCCAGTATTCGCCGTTCGGGAAACGAGCAATCACTGACATGCGCTTACGAT
CACTCGTGAACTCAAGTACGTCCAAAATCTGATACTCAATGAGCTCCGACTCCGCCTGTTTGTTCTTCATGAGTGCCTTGTTCGTCACACGCACACGAGC
GATACCAAGCCCACGAGACTCAAAACTAAATCCAAAGAATTTCGCTCCGCTGACAAGTGCCTGTTCGTCTGGAGAAGATGCCGACAAGCGCACTTCCGAG
CTGCCCTCTACCGTTTCAGGAATGACCGTGTGACACAAACTGAGGTGCAAGAAAAACTCGGCTTCCAAACAGCCTTGCTCCCCTTTGTCAAGCTTGCTGG
TAAGACGTTGGTCTTCGAAGTTGACGTATGGAATTTTGTTCTTCTTTGATGAACCGGATGGTGATTCCTCGGGCACAATCACACCCTTGCGCCGCAGGGC
AGCCCTTCCGATCTCtgTCGTACCGGTACCGTAAGAGATTCCGTTGATCGAGCACTTGCGGAACTCCATGACGTTGCACGTCAGAGTCCCGGTCTTGTCG
CTGAACACGTACGAGATCTGACCGAGTTCTTCGTTTAATCCCATCGAACGGACAATCATGCGTACGTCGAGTTCGTCGTAGTACATATCGATATCCCACA
CCATAAAGATAGCCTGGATGAACATGACCATCGAAATGGTCACATAAAGCGACACTGGGATCATCTGGTACATCAAGAGGAAGTAGTAGCCAAAGCCGAC
GAACCACTGtgACACATatCCTGGATTGTACATCAAATACAGGCTATCGGTCTTGTTGTTGTTGAGCCAAATAATCTGGATCGTCGTCGCAATAACACAA
AGCGTACACAACAACGTGAAAAGCCAGATGATCATCTTGTTCACGGTCTCATTGATAGAGCTCCACTTCGGgCGTGCCTTAGCTGCACTCTGCATGATCT
TCGTGTCTGGGCCCGTGTTGATGACGAGTCCGTACATCCACTCAGTGTTTCGCAATTGGCAGCCTCGCAACAGGATGTTCTTGATTGATACTGGCTGCTG
TTGCACtCCACCTCCTTCCGCACCATCCTTGCTTCCGCCAACGGAGAGCGTGCCATCGAAACGGCCAATGACACGGTTTGGGTTTtCACAGCGAAGGAAa
CCGCGAAGGTCCGTGACTTTAGCAGGCGTCAAAGCATGCAGAGTGCTGTCGCATGCGTGTCGGAGCTTCAGGTTGGTCTCTCCgTCGAGGGACTTGGTTT
CAACGTAGCAGATGCCGTTCGGCTCAGTAGGATTCGGTTCATCGACCGACAGAATGAGAAGGTCCGCTGGAGCCGTCTCACGGTTGCGTAGCTTCACGAT
AGTGCCGACGGTCAGCTCTGCCCAATGGATGACAGAGATCTCGGGgTCGTCGGTGCGCTTGAGCTTTGCGACAGTTACGTCGCCCGTAAAGGTCGAGGTG
ATGATCTGGCACTGCGCCGAGTTGGCTTCGTTGTCTGCTAGGTGGCGGCGACGGTCCTCGATGATCGCCAGGACGCCGTCAACGGCAAGAATAAACATGA
GCACGGGCAAGTTCGTGGGCAGGCCGTTTGTGTTACTGATgACGGGGATGCACTGCAGCACCGACACAAGGAGGAAGTAGGCGTTCGCGAGCTTGCGGAA
AGACTCGATCATAAAGAGCGGCAGGAAGTTCCAAGTCGTGTACTTGGACGTGATCACGACATTGGAGCAGAATtCCTGGACgTTAAAGGGGCGCTGCTGT
GGTAGCGGCTGTGGTAGCGGCACCGTGCGGTAGTCGTCATTTTCGTCGACTTCAGGTGTGCCTAGCTTTCCCCCCAGATTAGCGGCCGTTGTGGCAGTCG
CTGTGGTGCCCATACTCGCGGGtGGCTGCTGGATGTGGTCGAGGCGGAGGCCGGGGgCCGCGTTGTCGGCGCGCGACGTGTGGAGGTTGACGTAGCCGCT
GCTGGCGC