Description :
From Genome Similarity Track
Location :
Scaffold_41:152159- 153411
Sequence
1252 bases(100 bases per row)
GCCGATCCTACATCCTATCCTACGCCTGTTGCTGCAGCCTGCGGCTGCGCACTTACCGACGTGCCACGCGCGGATGCATGCGGCTATACCAAGTTTACTA
TGATCGATAGACAAGAGCGACCGTGCCGCCGTGCTGCTCACGACGACACTGACTTCGGTAAAGTATGGTTTATATTATTTTATGCATCGAATAGAACTTG
CGGAGAGGCGTACTGGCTTGCGTGAGGCTTGCTCTCTCTCTCTCACAACTCAACTTGCGGTTCAGCGAACCCCAGAGAGAAGAGCACGCCCACACCAGTA
CTGCAGCCCTGTCGTGGCCTTTTGATCGGCACTCACTGTGTTTACGTACCTCTTGTGATTGCTTTACTACTTAAGTGTAAGTCTATTCTAATGGCCCTAC
GCTAAGAAGTAACCTACGCTTAGAGAGCAGTCCAGTGACGCGCCCTGCGTCACCGCAGGAGTGTCCCGACCCAGACGCAAAAGCAAGGAACGAAGCCTAC
CTGGCTGGCCGTAAGCTGAAAGGCCTGTCGGCGGAAAACGAGCAGCGGGCGACCTGTAACTCCACAGGAAACAGCGACAACTGACTTGAGCACCCGCACG
CCGCACGACTACGAGCCAAATACAGTACGACACTGGTAGTACCGCGGGGAGAGCAGCTGACGGAGTGTGAGGACGCGACGAAGGAGAGCTGCAAGACCAG
CGAGAAGGTACCCGACGATAATGGGGATGCGAAGGCCGCGGTGGTGTTAGTGAGGAAGAAGAAGAAGTGGCGTCGCGTGACGAGTAAAAGGCACAACGCT
ACGTCGAGACAGTAAGGCCAACGATGGCCGCGCCGCGGTACGCTGGTACAGTCGCGAGTGAGGAAGGCGGTCGTACTGCAACAATCGATAAGGTACCGGC
AAGCGAGGAAGGCGGCGAGCAGGCCTCCATCGAGGAAGTTTCAACGCCAGCGGATGGCACGTCCTCGGTGCAAAGATGCCCAGGAAAGGATTGGAAGTCC
AGCGACGGTTACTTTCGTTCCCATGACAACGCCGTCACCATACTACACTCCTGGACACAGTTATACGGCCACCTCGTCGAGTGCCCATAACTCAGTCAAT
TTTTATTATTTGACGGTGTGGTTTTCACACAAGTTGCAAAACATGCTTCCAAATAACAAGGATGTGCTAACGCTCGCGTTTTTGCACTTTATAGTTAGGC
TCACATACAAAAAAGAGATTTGTCAAAGTGGACACAATTTACGGTCACCATG