Description :
From Genome Similarity Track
Location :
Scaffold_46:152153- 155463
Transcript NameFunction/comments
g1981.t1ACR19255.1 pectate lyase [Phytophthora capsici

Sequence
3310 bases(100 bases per row)
ACCACCGTGTTCTCCACGCAGTTGCGGCCCAGCGTGGACTTGCACGCCGACTGCGTCGACGACGACGGCACGATGATGGCCCCGACCGTCTCGGCGTCGT
GCTTGTTCGGGATGGCCGTGGACTCGAAGTAGTTGCCCTCCAGCAGCACGTTTCCGTTCTCGACAGCGTCGTACGAGAAGCCCGTGTTACTGTACCAGTA
GTTGTTGGCGGCGTGGACGATGGAGTTGCCGCCAACCTTCGGCGAGCGGCCCGACGTGTTGTGCACGTAGTTGTTCACGAGACTCACCTGCGTCTGCGTG
CCCAGGAAGAGGAAGGTCCAGTAGTGGTTGCCGTCGCACGTGGCCGAGTACTGCGTGCGGCCGTCGAACTCGGAATTGCTGATGGTCATGCTCTTGACGC
TGGCCGAGCCGGTGGCGATCATCTGGCGACCGATGTTGGAGATCTTGAGGTGGTCGAACCACACGCGCTGCATGGGGGTCTTACCACTGTTGAGGCCCTG
GATGTAGATGGCGTCACCGCCCCAGATGAGGTGCGGGTTCAGCTCCGTGATGTGGATGTTCTGGATGATGACGTTGTCACCCTGGATCCACAGGCCCTTG
CCCTTGATCACGCCGCTCGTGCCGAGGCCGCGGAGGGTCTTGTTGCTCGTGATCACGAGCGGGTTCTTGGAGGCCGCGAGGTCGTACGTGACCTTGACCG
AGGTGCCGTCCACGCAGCCGCCCGTGTTGGTCATGCCGCCGCTTTGCAGAATGACGTCCTGGCCCTTGTAGCCGTTGTTCTTGGCGAGGCAGTCGCGGTT
GCTCTTGGGGCGACAGCCATTCTCGGTCGTCGTGCCTTCCGTGCCGCGGAAGTCGAAGGTGGTCTTGAGCACGATGACGCGCGGCTGCGAATCCTTGAGG
TAGCTCTTGAGCTCGCTGACCGAGTTGGGGTACACGGGGTTGGCGTTACCGCCGCCGGTGGTGCCTGCCGCGAGGCCCGGTGCGGTGCCGGTGGAGAGGG
CCTGCGTACCCTGGAGGACCAGTGCCGTGATGGTGACGACGACGAGGTGGAAGATCTTCATGGTGTATAGTGTGGCGAACTGCTTGGTTTGTGCTGAGCC
GGGTTGGGTTGGATTCTTGGGGCTTGTGAGGCAAAATCGACAATGAGTCTGGTGTGGCTGTCCTCTGAGCTCGTCGACTTTGGAAGCAGGCGCACGCTGA
GTCAGGTGGCAGGGTGCGAGCGAGTCCAGGGAGGGGTCTTTTACTGCTCGTAAGTTGATTGCCGTTGCGCGACGGACTGTTGGCGAGAGAGCATGGGTCG
GAGTGAAATTCGTTGAGGAAAGGTACGGCTGAAACACGATCGGGGTCGCTGATGCCGACCAAGTGGTCATGGAGAAGGGGTACGTCATTTCATCACACCT
GCTGGGTTTACGGAGGCCCTTGTACTGCAGTGATTGCCGCAGGACACCCGCTGCCTGATGTTGACATCTGTGAGGAGGAGGCGGAGTCCAGCCACGGATA
CTCAGTTAGTCAGTGATTGTTTATAAGCGTTTTGATGTTGCCGAGGACGGGAATCGGTGGGCTTTAGAAGTTCGTAGGCAAGAATGGCGACTTGATATGC
CTGCCTATTATTATTGGTGGGCCACCACGTCGCTGCAGACACCCCTGACTTACACACTTGGGGATAGTAAAGCCTAAATATGATCTGGCAAAGCACAATC
GTTTCATTTTTCAGTCCGATACATATTTTAATATCACTAAGGCTTACAAAACGGCATCGCCTCGCAGTGCCAAATGCAGCAGGGAGTGTAGTGTGTGCAT
CATACACTTGCGCTGAACGGCCAACGACGTTATAATAGGTACCTACGAATATTACAGGCATATTGCATCACTTCTTTTGCAATAGTCGACATATCCTTGC
CGATTTGAAGTCGAGCGTTGCGCGACAGTGTCGAGATGACATCGCTACCTTCCTGATGCTCGGCAAGCAGCATAGAGGACATTCGCTCGTACGTAGCTTG
CTGCGGTGGAGGTTTCGCGTCGCGCGCATGATGGTACCAATACGCTGATAGCGATGCTCAAGTTGGAGATTTGATCCGTGCACTGTTGTACCAGTATTTG
AGTACATGTAGTGAAGTGCATTCACTGCTCGCGGGTCTGACTCAATACGATCTACGCAAATACGAAGTAATTCATTGCGCTACATGTATCCAAGACAAAT
CAAAAGTGCGGGTGGGGTCTGTAACGGCCCGAGTTGCGCCACTGCGATCGACGGTCAGGAATCTAATCTAATATGCACACAGCAGGAAGTGAGCCACGTG
CACGTTGCGGACTAACGTTCTTAATTCACCTCGTTACAACTCGCCAAGGACCCTCAGGTGGTCGTCGTGACAGCAAACAAAAGTTAGCACCGAGAAGGAT
TTTAGCGCTGTGCTCGAAGAACAACAAAAAGACAAGCGCAGCAACGCTTGCTATCGCACTAAATAACGAGTAAGGTTGTTATTCGGTTGTCAGAATTTCA
ATTAGTGGGGCTTTCAATCGTTTTTGGTTTTAAAAGGCAACGAGATTTCCTATCAGCTGGTGCTTTTTTGAAAAGATCACCACACAGCTACATGTCGGTA
GGATGGGAATTCGGTCGGATGTTGAAGTCGTCAATTGTGGCGCCAATTGCAACTTGCAGGCGTATCGACCACCCTCACGATAGACATCTGCACACAGTAC
CGGGTACATTCATATTCATGTTCTTCAAGTCCAGGAGGTTTCATGGATTCGTCTTGGAGGCAATCGTTGTGAGACTCAACAACGAGAGTATACTGTATAC
GGTAGTTGAAAGCACACTGCGTCGACACAGACTTAGACGCTAAGTCCGCGACCGCGACCTCCATACCGTTGGGGAGAATATGGCATCAATCAGCATGCGC
TGCAGTACATTATCTACAGCTGCGTGCTGCACCTTCTGAAGTGGAGAATTTAGTGAGCTGACCGCAACATATAATTCGACGCTCGCCCCCGTAGCAGATG
GCCACTTTCAAATCTATTCGCCAGATCGAGTACACGTATTAAAAACAGCGCGAAAGTCGACGGCGCGAAACATTGGCCAGAAACACTGGCGTGACTGCAG
GCTTTGTGCTCTGCTGCTATTTATATGGGCTCCAAGCTTGAACTAATCCGAAAGACACGTTTTGCATTCTTTAAAACTGCACCATTTTTTTTATAGTGTC
TGGGTTCCCAGGCATCTGCGGCGTTAGGTGTGTTGATTGACCTGCCACGCACTGCAGAGGAAAACAACATCATCTGTCTTCATTTCCAAAACTGCTCTAG
GTGAGTATCA