Description :
From Genome Similarity Track
Location :
Scaffold_374:15212- 18875
Transcript NameFunction/comments
Phyke_g9681hypothetical protein PHYSODRAFT_258180

Sequence
3663 bases(100 bases per row)
AAGATTTGAAATCGGTGCTTGGTCTTACCTTAGTGTGAGGTGATGCCATGCCGCGGCTCATGTTCTATCCGTTCCGTAATATCAGGATGTCCCCACAGGA
TGTGTGAAAGGTTCAACGAACAAAAGTATCTGTACGATCAGTGCTTTTACCAACAGATCCAATTGATTCGTAGTACTGGGCGGCACTTGAGCGCAAGAGA
GATTTTATTGAATGGTGTTCATCCAAGCACATGTGCCTTTCCAATAGTCGCAACAATCACAAGTCGACGATTATGGCGAAATTCCCGAACGACGAATGAA
ACTCATGTAAAAAGGACGTGTCTTTCCAATACAGTGCCGTAGAGGGAGTTGTATTGCAAATTGTTACATTATGCCGAAGCACATGGCCCGCGTTCTTACA
CGCCTGGGTGAAGACCGAGGAAACCAGGACTCGGTTCACCCTGCACCTCGCCGAAATACAGAGCGAACGTCTGTTTCCACTGCTCTACCTTTTCGCGGTC
TGCCATAAACTTAGGGAAGGCGTCCATGTTGGCTTCTGGGGTGTTCCAGGGCGTGCTTGTACTGATGTCCGTGCGCACACTTGAAAAAACCACCGATGTT
TGAGCTTCCTTCGACACGGCCCAGTTCATGAACAATTTTGCAGCGGCAGGGTGCTTAGCCTTTTTCAAAATGCCAACACGCTGACCCCAACTGAGATAGT
CGGTGCCGTTACCTCCCACGAACTCGATcgcaccgccaccacctccggtGCCGACGCCAATCAACTTCTCTCCGGAACTCACGAGACCTCCTGCAACATT
TGAGCCACGGTTGAAGTCGATGTTCTGCTGAGCCATTTTGGACACCCAGTCCCAACCGTACTTCTCCACATAGCGCGTGTAGAGGAACAGCACAGCGTCA
TCATCGTGAGGGTACGACGAGGCAATCTTGCCAGACCACTGCGGTTCTGTCAGATCAGCCGGGGTGGTAGGCGCCGCCGTTCCGTTGATTGCACTCGAGT
TATAGACATAACCGAACGTGAAAATGGTGTAAGCCATCCAAGCACCGTTCTTGTCTTTCAACGAATTGTGAATCTTGGAAAAGTCTTTCGGCTTGTAGGA
GAGAAGTTTCCCTTCCTGTCCCCATCGAGTGAAGTCCTGAAGCGTTTGAAGGGCTACAACATCGGGAACCAACGAGTCGGTCTCGAGCTGGTTGTCAATA
CGGACGTCGTGATACTTGCTGTAGTCAACGACTACAGTAAAGTTGATCTCCGGAAAGCGCTGCGAGAAAGCTTCTTGTAGACTGTCTTGTTGAGTAGGGG
TGTCACCGCCGTGGTACAGGACAAGCTTGCCGCCTTCAGTTATAGCTTCAGCATAGAGATCGTCGATAGTCTTGGACTCTTCATCTGACTTGGCTACGCT
GCCAGAGGCAAAGAGAGCGCATGCAATAACGAGTGGTGCGAACAATTGCATGGTGGCAGTTCTTTGGTGATTACTGTGAATTGGCACTTGAGGCAAAAGC
AGTAAATTAGAGAATGAGGCTACTTCTGGACTGCTGAGCTGACAGTAGAATAGCTGCGAGGGTAGAAAGAAAGATTTCACCGGAGCTGTGGTCTACTGTT
TGCAGGTGAAGCCGCTCGGACGTAGTGTCAGTGACTACATACTGCCGTACCGCCACACCTGAGGTAGAATGCCGGTACAATAGTTCTAATCGTTATCgat
tttgctgtttgtccACTTTCAGCACATCGTGCCGCCACGCCTTGGTCTGGCTGTAGGGTGACATGATGAAAACGATTTGGGAACCACCCTCAGATCAGCA
GCTGTGTCCCACGAAGGCATATCCTCCAACTATACGCGCAGGCAACACACGCGTAGTGTTAGCAACCCGATGTGTTTACGAAAAGGGAAAGTTTTCTTTC
CCTATGGTATCCACGCAACAATTATCGGcaggtaaaaaaaaagaacTTATTTCGCTACTCACTATTTTTTAACGAAAGAATGAACTCCATCATACCCACA
ATCGTAACGAAACGATAGGAGTGCATCGAATAGCACCCTCGAAGCGGTGTTATTCCCGATCACCCTTTGTTACTACATACCAGGATGAAGCCCAAGCCAT
CCTGGCGACGGCTTGCCCTGTACCTCGCCAAAATACAGCGTGAAGGTCTGACGCCAGGAGTGTCGTCTCAGGTGTACATGGCATGCGTTCCACCTTCGGT
CACAGCATCTGCATATATATCGTTGATAATCTTAGACTCTTCAGAGGATTCGGTAATGGCGTCAGAGAAGAGGACCGCGGAAGACAAAAGCAGCGAGGCA
GTGAACTTCAAATCGATAGGCTCGCAAGATAAAAGGCGCGAGGTATAACGCGGCTGAGACGAAAGAGATAATTTCGATTCGGGCTACCCCCGGGCAATGT
GGACTCTATGTCCTTGACAAAGCTAGCATGCGTCCCGGCTCACGGATATCGCACTGGGAAATGTGTTTGCTCTGTTAACGCGTGCCGTCTGATTCTAGGT
CCTATACATGCAACTTGCTCACATCGGTATCCAAAGATTATTACCCAGGTGAAGAGGGTGGGTGGGGGCAATTCGCCAAAAACATTTGGCACGCATCGGG
GATCACGTGAGATCGTCCGGTGTCGACTATCCAATTCAAATTGGGCCAATTGAGCGGTGGGAATTCAGCCTGTCGACGGTGTGGAGCTCAGTTTACGCAG
TAGCCCCTGGAAATACGGGATATCGGAGCAGCCAACGTCGTATCTTGCTTTTCACATTATGGCGGTAGTTGGTGTCCAGGTCATAATTGTCCGCAAATGT
AAATCTTATCTGGGTAGTGAAAGCCTTAAGGCCCGTTATTAGCCAGTCGCATGCGCCACATCACCAACAGGAAACGTATGGTGCTGGTTAGGATGGGAGC
AAAGCATTTTCAAATGATCCTACGCACCGACTGCACTTTGCCATTTATGAGTCAATTCAGCCCAATAAAGCGTAATGTCAAACGTTTGTTCCGTGTTTTT
GGTTGTGGTGCGTTTTGCACCTACTTTGGCGTCGGTCTTCATGCAGGCTACTAGTTGATCAGATTTGTGCTGCCGTGACCCACAACAGTATCGCTTGTAG
TCGAAGCTGATCGGGCTAGCACCATAAGTATATTTCACAGAATGCACTCTCATGCAGAAACAGTAGATCTCTGCACTGGAAGCCAACCAGTTTGGCGGCA
GAGAATACATGGTTGGCATCGTGCGAGCTTACAATGTCTAGCTGCCACGGAGTTTACGCAATAGTGCTCGAGCATACGGGATTGCGAGGCGACAAGCGCC
ATATCCAACCTAGATTAGATGAGCTACTAGCCAACAAATCCCTTTTCCTTTCCTTGAAGATAGTATGGATTGAGGGCCTCGATGTGCATTTTACCCATCA
GTGCGCAGTTCCAGTCCTTTGTCATCTCCTGGGTAGTGGTATCTACATTCAACGAACGGTGTGAACGTTGAGTGTGCGTTCGCATTGTACATTCGTACGG
TGTCGAAAAAATTGTAAAGGCTCATTTCTTTGCCATGACTTTTGTTACCTTTACAAATTCTGCCTCATACAAGTGCCAAATCTGCATCACCATGACCAGC
ACCAGCGAgactgctcatcttgtagatcgttgGTACGTTTGGGGCCCGCGTCGGCTAAAGCCG